Transcript: Human NM_001353537.2

Homo sapiens zinc finger protein 532 (ZNF532), transcript variant 17, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF532 (55205)
Length:
5623
CDS:
238..3609

Additional Resources:

NCBI RefSeq record:
NM_001353537.2
NBCI Gene record:
ZNF532 (55205)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230138 GCCTCCAAACTTGGGTATAAA pLKO_005 2616 CDS 100% 15.000 21.000 N ZNF532 n/a
2 TRCN0000218616 TGCAATGCTCCCACTTAATTT pLKO_005 2261 CDS 100% 15.000 21.000 N ZNF532 n/a
3 TRCN0000219826 AGGCCACATAGGTCCGAATAA pLKO.1 5413 3UTR 100% 13.200 18.480 N ZNF532 n/a
4 TRCN0000230136 CGGTGAAAGCCACGGTCATAT pLKO_005 1661 CDS 100% 13.200 18.480 N ZNF532 n/a
5 TRCN0000242174 CGGTGAAAGCCACGGTCATAT pLKO_005 1661 CDS 100% 13.200 18.480 N Zfp532 n/a
6 TRCN0000153605 CCAGATATGGTCGATCCTAAA pLKO.1 298 CDS 100% 10.800 15.120 N ZNF532 n/a
7 TRCN0000154157 CGTCAAGAATGTTCGGAACAT pLKO.1 429 CDS 100% 4.950 6.930 N ZNF532 n/a
8 TRCN0000156384 CGTTGCGCCATCAAAGACAAA pLKO.1 1002 CDS 100% 4.950 6.930 N ZNF532 n/a
9 TRCN0000151697 CCAAACCTCAGCAACAAATAA pLKO.1 1871 CDS 100% 15.000 10.500 N ZNF532 n/a
10 TRCN0000219825 TATGCACTCCATCCATCATAA pLKO.1 5023 3UTR 100% 13.200 9.240 N ZNF532 n/a
11 TRCN0000230139 TATGCACTCCATCCATCATAA pLKO_005 5023 3UTR 100% 13.200 9.240 N ZNF532 n/a
12 TRCN0000156932 GCAAAGAACCAGTGGCCAATT pLKO.1 1097 CDS 100% 10.800 7.560 N ZNF532 n/a
13 TRCN0000157421 GCTGCAATTCCACGAACACAT pLKO.1 3261 CDS 100% 4.950 3.465 N ZNF532 n/a
14 TRCN0000158371 CGGAAGTTGGAAGAACCAGTT pLKO.1 3130 CDS 100% 4.050 2.835 N ZNF532 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14189 pDONR223 100% 70.8% 69.9% None (many diffs) n/a
2 ccsbBroad304_14189 pLX_304 0% 70.8% 69.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476591 TGGGGGAACTCGCTGTCTTTAGGC pLX_317 9.1% 70.8% 69.9% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000479609 CGTCGCCAGGTAAAATCCAATCGC pLX_317 8.6% 70.8% 69.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV