Transcript: Human NM_001353641.2

Homo sapiens NAD kinase (NADK), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
NADK (65220)
Length:
3180
CDS:
168..1508

Additional Resources:

NCBI RefSeq record:
NM_001353641.2
NBCI Gene record:
NADK (65220)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146533 GGTGGAAGGCCATGACCGGA pXPR_003 GGG 599 45% 7 0.9226 NADK NADK 78071
2 BRDN0001487076 CAAGTTACTCAGGTGATAGA pXPR_003 GGG 683 51% 7 0.9218 NADK NADK 78072
3 BRDN0001146052 AAATTCTGTACCTTTCGAGA pXPR_003 AGG 494 37% 5 0.1634 NADK NADK 78073
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194792 CGCAAATCAGTCGGTTGAAAT pLKO.1 1814 3UTR 100% 13.200 18.480 N NADK n/a
2 TRCN0000037700 CGATGAGACCTGGAGTTACAA pLKO.1 251 CDS 100% 5.625 7.875 N NADK n/a
3 TRCN0000199808 GCATTGGAACGTCCGGAAGAA pLKO.1 1442 CDS 100% 4.950 6.930 N NADK n/a
4 TRCN0000037701 TCGAGAAGATTATGATGACAT pLKO.1 659 CDS 100% 4.950 6.930 N NADK n/a
5 TRCN0000197097 GCTAGTGATCGTGATCCCTTT pLKO.1 2400 3UTR 100% 4.050 5.670 N NADK n/a
6 TRCN0000199040 CGTGAGCGACTGGTTTGAGAG pLKO.1 1406 CDS 100% 1.350 1.890 N NADK n/a
7 TRCN0000230041 AGGAGAACATGATCGTGTATG pLKO_005 559 CDS 100% 10.800 7.560 N NADK n/a
8 TRCN0000230043 TGCAGTACCAGGTCCTGAATG pLKO_005 1000 CDS 100% 10.800 7.560 N NADK n/a
9 TRCN0000196568 GATGACATTTCCAATCAGATA pLKO.1 672 CDS 100% 4.950 3.465 N NADK n/a
10 TRCN0000037702 GCATCAGCATCACTACCTCAT pLKO.1 1351 CDS 100% 4.050 2.835 N NADK n/a
11 TRCN0000196721 GAATAAGGAATTGAGTCCAGA pLKO.1 197 CDS 100% 2.640 1.848 N NADK n/a
12 TRCN0000037703 GAGAACTTTCAGTCCCAAGTT pLKO.1 819 CDS 100% 0.495 0.347 N NADK n/a
13 TRCN0000230042 GTACCTTTCGAGAAGATTATG pLKO_005 652 CDS 100% 0.000 0.000 N NADK n/a
14 TRCN0000230044 TGCTCCCAGGAAGGTAGTTTA pLKO_005 2163 3UTR 100% 13.200 7.920 N NADK n/a
15 TRCN0000218412 CATTCAGCTTTGAGAACTTTC pLKO_005 808 CDS 100% 10.800 6.480 N NADK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08892 pDONR223 100% 99.9% 99.7% None 786C>A n/a
2 ccsbBroad304_08892 pLX_304 0% 99.9% 99.7% V5 786C>A n/a
3 TRCN0000471738 TACAGAGCCGCCAGAGATGGGTGG pLX_317 2.2% 99.9% 99.7% V5 786C>A n/a
4 ccsbBroadEn_15141 pDONR223 0% 99.9% 99.7% None 786C>A n/a
5 ccsbBroad304_15141 pLX_304 0% 99.9% 99.7% V5 786C>A n/a
6 TRCN0000474095 TAATGCGGTTTCATTAGCGCGCCT pLX_317 33.7% 99.9% 99.7% V5 786C>A n/a
Download CSV