Transcript: Human NM_001354400.1

Homo sapiens diphosphoinositol pentakisphosphate kinase 1 (PPIP5K1), transcript variant 26, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
PPIP5K1 (9677)
Length:
5659
CDS:
986..4447

Additional Resources:

NCBI RefSeq record:
NM_001354400.1
NBCI Gene record:
PPIP5K1 (9677)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146565 GGAGTACGGGATCAGTCGGG pXPR_003 AGG 1573 45% 20 0.6839 PPIP5K1, PPIP5K1P1-CATSPER2 PPIP5K1 76306
2 BRDN0001146986 ACCTGCAGGTGTATACAGTG pXPR_003 GGG 21 1% 8 0.6193 PPIP5K1, PPIP5K1P1-CATSPER2 PPIP5K1 76307
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128325 GTAGATGGTAACTCCCAATTT pLKO.1 3701 CDS 100% 13.200 18.480 N PPIP5K1 n/a
2 TRCN0000149817 CAATCTGTTATCTCAGGGCAT pLKO.1 4345 CDS 100% 2.160 1.728 N PPIP5K1 n/a
3 TRCN0000146401 CTGGTCCATAAGTTCCATGTA pLKO.1 4190 CDS 100% 4.950 3.465 N PPIP5K1 n/a
4 TRCN0000128293 GAGATTGATAAACCATCCCAA pLKO.1 4370 CDS 100% 2.640 1.848 N PPIP5K1 n/a
5 TRCN0000128377 GCTACAAGACAGGGAAATTAA pLKO.1 1500 CDS 100% 15.000 7.500 Y PPIP5K1 n/a
6 TRCN0000431015 ACGTTCGAACGCGTCTCTATT pLKO_005 2703 CDS 100% 13.200 6.600 Y PPIP5K1 n/a
7 TRCN0000426823 AGCGTCTCTTTCGTAAGATTG pLKO_005 838 5UTR 100% 10.800 5.400 Y PPIP5K1 n/a
8 TRCN0000428411 GGGCGCTATGATATCAGTAAG pLKO_005 2402 CDS 100% 10.800 5.400 Y PPIP5K1 n/a
9 TRCN0000178466 GCGCTATGATATCAGTAAGAT pLKO.1 2404 CDS 100% 5.625 2.813 Y Ppip5k1 n/a
10 TRCN0000198957 GATCAGGTATTTGCCCTGATT pLKO.1 2246 CDS 100% 0.495 0.248 Y Ppip5k1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11402 pDONR223 100% 39.7% 39.6% None (many diffs) n/a
2 ccsbBroad304_11402 pLX_304 0% 39.7% 39.6% V5 (many diffs) n/a
3 TRCN0000480975 CACTCCTTTAGCACTTATAGATCG pLX_317 16.6% 39.7% 39.6% V5 (many diffs) n/a
Download CSV