Construct: ORF TRCN0000480975
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007060.1_s317c1
- Derived from:
- ccsbBroadEn_11402
- DNA Barcode:
- CACTCCTTTAGCACTTATAGATCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PPIP5K1 (9677)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480975
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_017022759.1 | 99.9% | 100% | 1929G>A |
| 2 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354395.1 | 59.7% | 59.8% | 1929G>A;2452_4098del |
| 3 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354396.1 | 59.7% | 59.8% | 1929G>A;2452_4098del |
| 4 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354397.1 | 59.7% | 59.8% | 1929G>A;2452_4098del |
| 5 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_006720786.2 | 59.7% | 59.8% | 1929G>A;2452_4098del |
| 6 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_017022754.1 | 59.7% | 59.8% | 1929G>A;2452_4098del |
| 7 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354394.1 | 58.8% | 58.6% | (many diffs) |
| 8 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001190214.1 | 58% | 58.1% | 1929G>A;2452_4218del |
| 9 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354393.1 | 58% | 58% | (many diffs) |
| 10 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_017022753.1 | 58% | 58% | (many diffs) |
| 11 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001130859.2 | 58% | 58% | 1929G>A;2452_4224del |
| 12 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354390.1 | 58% | 58% | 1929G>A;2452_4224del |
| 13 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354391.1 | 58% | 58% | 1929G>A;2452_4224del |
| 14 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354392.1 | 58% | 58% | 1929G>A;2452_4224del |
| 15 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_014659.5 | 58% | 58% | 1929G>A;2452_4224del |
| 16 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_005254804.1 | 58% | 58% | 1929G>A;2452_4224del |
| 17 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_017022748.1 | 58% | 58% | 1929G>A;2452_4224del |
| 18 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_017022747.1 | 57.6% | 57.6% | 1929G>A;2452_4248del |
| 19 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354387.1 | 57.1% | 57.1% | (many diffs) |
| 20 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354388.1 | 57.1% | 57.1% | (many diffs) |
| 21 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354389.1 | 57.1% | 57.1% | (many diffs) |
| 22 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354382.1 | 57.1% | 57.1% | 1929G>A;2452_4287del |
| 23 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354383.1 | 57.1% | 57.1% | 1929G>A;2452_4287del |
| 24 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354384.1 | 57.1% | 57.1% | 1929G>A;2452_4287del |
| 25 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354385.1 | 57.1% | 57.1% | 1929G>A;2452_4287del |
| 26 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354386.1 | 57.1% | 57.1% | 1929G>A;2452_4287del |
| 27 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_017022741.1 | 57.1% | 57.1% | 1929G>A;2452_4287del |
| 28 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001130858.2 | 56.9% | 57% | 1929G>A;2451_4299delinsG |
| 29 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_017022739.1 | 56% | 56% | 1929G>A;2452_4374del |
| 30 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_017022738.1 | 55.2% | 55.2% | (many diffs) |
| 31 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_011522249.1 | 55.2% | 55.2% | 1929G>A;2452_4437del |
| 32 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_011522250.1 | 55.2% | 55.2% | 1929G>A;2452_4437del |
| 33 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_011522252.1 | 55.2% | 55.2% | 1929G>A;2452_4437del |
| 34 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_011522254.1 | 55.2% | 55.2% | 1929G>A;2452_4437del |
| 35 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_017022735.1 | 55.2% | 55.2% | 1929G>A;2452_4437del |
| 36 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_017022736.1 | 55.2% | 55.2% | 1929G>A;2452_4437del |
| 37 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_017022737.1 | 55.2% | 55.2% | 1929G>A;2452_4437del |
| 38 | human | 110006325 | PPIP5K1P1-CATSPER2 | PPIP5K1P1-CATSPER2 readthrough | NR_146339.1 | 46.3% | (many diffs) | |
| 39 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354398.1 | 39.7% | 39.6% | (many diffs) |
| 40 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354399.1 | 39.7% | 39.6% | (many diffs) |
| 41 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | NM_001354400.1 | 39.7% | 39.6% | (many diffs) |
| 42 | human | 9677 | PPIP5K1 | diphosphoinositol pentakisp... | XM_011522258.1 | 37.8% | 37.7% | (many diffs) |
| 43 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_017319033.1 | 69.4% | 74.9% | (many diffs) |
| 44 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_006499744.2 | 64.5% | 69.6% | (many diffs) |
| 45 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_017319030.1 | 63.7% | 68.8% | (many diffs) |
| 46 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_006499743.2 | 62.2% | 67.1% | (many diffs) |
| 47 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_006499742.3 | 61.1% | 66% | (many diffs) |
| 48 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239620.2 | 58.2% | 62.8% | (many diffs) |
| 49 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239618.2 | 53.8% | 58.1% | (many diffs) |
| 50 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_017319029.1 | 52.8% | 57% | (many diffs) |
| 51 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239617.2 | 52.2% | 56.3% | (many diffs) |
| 52 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239616.2 | 51.9% | 56% | (many diffs) |
| 53 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_017319027.1 | 51.5% | 55.6% | (many diffs) |
| 54 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_017319028.1 | 51.4% | 55.5% | (many diffs) |
| 55 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | NM_178795.4 | 51.4% | 55.5% | (many diffs) |
| 56 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_006499741.3 | 51.4% | 55.5% | (many diffs) |
| 57 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239615.2 | 50.4% | 54.4% | (many diffs) |
| 58 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_017319026.1 | 50% | 54% | (many diffs) |
| 59 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239614.2 | 49.8% | 53.7% | (many diffs) |
| 60 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_006499740.2 | 49.7% | 53.7% | (many diffs) |
| 61 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239613.2 | 49.3% | 53.3% | (many diffs) |
| 62 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_017319025.1 | 49.3% | 53.3% | (many diffs) |
| 63 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239612.2 | 48.9% | 52.8% | (many diffs) |
| 64 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239611.2 | 48.4% | 52.2% | (many diffs) |
| 65 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_006499739.2 | 47.7% | 51.5% | (many diffs) |
| 66 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239603.1 | 47.7% | 51.5% | (many diffs) |
| 67 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239604.2 | 47.7% | 51.5% | (many diffs) |
| 68 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239605.2 | 47.7% | 51.5% | (many diffs) |
| 69 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239606.1 | 47.7% | 51.5% | (many diffs) |
| 70 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239607.2 | 47.7% | 51.5% | (many diffs) |
| 71 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239608.1 | 47.7% | 51.5% | (many diffs) |
| 72 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239609.2 | 47.7% | 51.5% | (many diffs) |
| 73 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239610.2 | 47.7% | 51.5% | (many diffs) |
| 74 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XR_001783061.1 | 34.4% | (many diffs) | |
| 75 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XR_001783060.1 | 34% | (many diffs) | |
| 76 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XR_001783058.1 | 33.3% | (many diffs) | |
| 77 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XR_001783059.1 | 33.2% | (many diffs) | |
| 78 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239619.2 | 32.5% | 35.2% | (many diffs) |
| 79 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_017319034.1 | 28.8% | 31.6% | (many diffs) |
| 80 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_017319032.1 | 28.4% | 31.1% | (many diffs) |
| 81 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_017319031.1 | 27.2% | 29.9% | (many diffs) |
| 82 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XM_011239621.1 | 26.3% | 28.9% | (many diffs) |
| 83 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XR_001783068.1 | 21.6% | (many diffs) | |
| 84 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XR_001783066.1 | 21.1% | (many diffs) | |
| 85 | mouse | 327655 | Ppip5k1 | diphosphoinositol pentakisp... | XR_001783064.1 | 20.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2517
- ORF length:
- 2451
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg gtcattgacg gccagtgagg gcgagagtac cacggcccac ttcttccttg 121 gagctggaga tgaggggctg ggcacccgtg gaataggcat gaggccagaa gagagtgaca 181 gcgagctcct tgaggatgag gaggatgaag tgcctcctga acctcagatc attgttggca 241 tctgtgccat gaccaagaaa tccaagtcca agccaatgac tcaaatccta gagcgactct 301 gcagatttga ctacctgact gttgtcattc tgggagaaga tgtaatcctt aatgaacctg 361 tggaaaactg gccatcctgc cactgcctca tctctttcca ctccaaaggc tttcctctgg 421 acaaagctgt tgcttactcc aagcttcgaa acccctttct tatcaatgat ctggccatgc 481 agtattacat ccaagatagg agggaggtgt accggatcct gcaggaagag ggtattgatc 541 tgcctcgata tgctgtgctc aaccgtgatc ctgcccggcc tgaggaatgc aacctgatag 601 aaggtgaaga ccaagtagag gtcaatggag ctgtctttcc caagcccttt gtggagaagc 661 cagtgagtgc agaagaccac aatgtttaca tctactaccc cagctcagct ggaggaggaa 721 gccagcgtct ctttcgtaag attggcagcc gaagcagtgt ttactctcct gagagcagcg 781 tccgaaagac ggggtcgtac atctatgagg agtttatgcc aacagatggc acagatgtca 841 aggtgtatac agtggggcca gattatgccc atgctgaagc tagaaaatct ccagctttgg 901 atgggaaggt tgaacgagac agtgagggga aagagattcg atatccagtc atgctgactg 961 ccatggaaaa gctggtggcc aggaaagtct gcgtagcttt caagcaaaca gtttgtggat 1021 ttgaccttct tcgtgccaat ggtcattcct ttgtgtgtga tgtcaatggc tttagttttg 1081 tcaagaactc gatgaaatac tacgatgact gtgccaagat tctggggaac accataatgc 1141 gggagcttgc cccacagttc cagattccat ggtccatccc cacggaggct gaggacattc 1201 ccattgttcc caccacatct ggcactatga tggaacttcg ttgtgtcatt gcaattattc 1261 gtcatgggga tcgtactccc aagcagaaga tgaagatgga agtgaaacac ccaaggtttt 1321 ttgctctgtt tgaaaaacat ggtggctaca agacagggaa attaaaactc aagcgacctg 1381 agcagctcca ggaggtgctg gatatcacaa ggctgttgtt ggctgaactg gagaaagaac 1441 caggtggtga gatcgaggag aagactggaa aactagagca gctgaagtct gtactggaga 1501 tgtatggtca cttctcaggt ataaaccgga aggtacaatt gacttactac cctcatggag 1561 taaaagcttc taatgagggg caagatccac agagggaaac tctggcccca tctctgttgc 1621 tggtactgaa gtggggtgga gaactgactc ctgctggccg tgttcaggct gaggagctgg 1681 ggcgagcttt tcgctgcatg taccctggag gacagggtga ctatgctggc ttccctggtt 1741 gtgggctgct tcgtctccat agcactttcc gccacgatct caagatctat gcctctgatg 1801 agggtcgtgt tcagatgact gctgctgcct tcgccaaggg ccttctggct ctagaagggg 1861 agctgacacc cattttggtg caaatggtga agagtgccaa catgaatggg ctactggaca 1921 gcgatgggga ttccttgagc agctgccagc accgggtgaa ggctcggctg caccatattc 1981 tacagcagga tgcacccttt ggccctgagg actacgatca gctggctccc accagaagta 2041 cttccctgct caactccatg actatcatcc agaatcctgt gaaggtctgt gatcaggtat 2101 ttgccctgat cgaaaaCCTC ACCCACCAGA TCCGGGAACG AATGCAGGAC CCCAGGTCTG 2161 TAGACCTGCA GCTCTACCAC AGTGAGACAC TAGAGCTAAT GCTACAGCGT TGGAGCAAGC 2221 TGGAGCGTGA CTTTCGACAG AAGAGTGGGC GCTATGATAT CAGTAAGATC CCTGACATCT 2281 ATGACTGTGT CAAGTATGAT GTGCAGCACA ATGGGAGTCT GGGACTTCAA GGCACAGCAG 2341 AGTTGCTCCG TCTCTCTAAG GCACTGGCTG ATGTGGTCAT TCCCCAGGAG TACGGGATCA 2401 GTCGGGAGGA GAAACTGGAA ATTGCTGTGG GCTTCTGTCT TCCACTGTTG CGGAAGATAC 2461 TACTTGACCT GCAGAGAACC CACGAGGATG AGTCTGTCAA CAAGCTGCAT CCCCTGTGCC 2521 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 2581 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 2641 ATATATCTTG TGGAAAGGAC GACACTCCTT TAGCACTTAT AGATCGACGC GTTAAGTCga 2701 caatcaacct ctggattaca aaatttgtga aagatt