Transcript: Human NM_001354479.2

Homo sapiens ring finger and CCCH-type domains 2 (RC3H2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
RC3H2 (54542)
Length:
8793
CDS:
318..3722

Additional Resources:

NCBI RefSeq record:
NM_001354479.2
NBCI Gene record:
RC3H2 (54542)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354479.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294352 TCGCTTTGTGAGGTCCAATAA pLKO_005 2219 CDS 100% 13.200 18.480 N RC3H2 n/a
2 TRCN0000037012 CCCAGCTAATCTCACGTAGTA pLKO.1 1828 CDS 100% 4.950 6.930 N RC3H2 n/a
3 TRCN0000286937 CCCAGCTAATCTCACGTAGTA pLKO_005 1828 CDS 100% 4.950 6.930 N RC3H2 n/a
4 TRCN0000251864 ATTGGTCGTCTGAGCTATTTA pLKO_005 5233 3UTR 100% 15.000 12.000 N Rc3h2 n/a
5 TRCN0000307299 ACCAGATCATCAGTCAATTAA pLKO_005 551 CDS 100% 15.000 10.500 N RC3H2 n/a
6 TRCN0000294353 ACTGTAACAGAACTGATATTA pLKO_005 801 CDS 100% 15.000 10.500 N RC3H2 n/a
7 TRCN0000037013 CCCATCAGTGTATCAGATTAT pLKO.1 2946 CDS 100% 13.200 9.240 N RC3H2 n/a
8 TRCN0000286886 CCCATCAGTGTATCAGATTAT pLKO_005 2946 CDS 100% 13.200 9.240 N RC3H2 n/a
9 TRCN0000376220 TGGAAGCAGGACTCCGTATTT pLKO_005 1183 CDS 100% 13.200 9.240 N Rc3h2 n/a
10 TRCN0000037009 CCTGTATAAATGCCATTGATT pLKO.1 2683 CDS 100% 5.625 3.938 N RC3H2 n/a
11 TRCN0000037011 CCACCTATGTACCAACGAGAT pLKO.1 2424 CDS 100% 4.050 2.835 N RC3H2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354479.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12056 pDONR223 100% 42% 40% None (many diffs) n/a
2 ccsbBroad304_12056 pLX_304 0% 42% 40% V5 (many diffs) n/a
3 TRCN0000479379 GTGGGCATATAACACATGTAAGCG pLX_317 20.4% 42% 40% V5 (many diffs) n/a
Download CSV