Transcript: Human NM_001354651.1

Homo sapiens 8-oxoguanine DNA glycosylase (OGG1), transcript variant 2g, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
OGG1 (4968)
Length:
2102
CDS:
344..1264

Additional Resources:

NCBI RefSeq record:
NM_001354651.1
NBCI Gene record:
OGG1 (4968)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004916 CGGATCAAGTATGGACACTGA pLKO.1 522 CDS 100% 2.640 3.696 N OGG1 n/a
2 TRCN0000314669 CGGATCAAGTATGGACACTGA pLKO_005 522 CDS 100% 2.640 3.696 N OGG1 n/a
3 TRCN0000314672 TGTGCCCGTGGATGTCCATAT pLKO_005 1135 CDS 100% 10.800 8.640 N OGG1 n/a
4 TRCN0000004915 CGGCTCATCCAGCTTGATGAT pLKO.1 848 CDS 100% 0.495 0.396 N OGG1 n/a
5 TRCN0000314740 CGGCTCATCCAGCTTGATGAT pLKO_005 848 CDS 100% 0.495 0.396 N OGG1 n/a
6 TRCN0000004913 CGCAAGTACTTCCAGCTAGAT pLKO.1 632 CDS 100% 4.950 3.465 N OGG1 n/a
7 TRCN0000314739 CGCAAGTACTTCCAGCTAGAT pLKO_005 632 CDS 100% 4.950 3.465 N OGG1 n/a
8 TRCN0000004914 GATGTCCATATGTGGCACATT pLKO.1 1145 CDS 100% 0.000 0.000 N OGG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06670 pDONR223 100% 87.6% 86.9% None (many diffs) n/a
2 ccsbBroad304_06670 pLX_304 0% 87.6% 86.9% V5 (many diffs) n/a
Download CSV