Transcript: Human NM_001354683.2

Homo sapiens zinc finger and BTB domain containing 25 (ZBTB25), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZBTB25 (7597)
Length:
2922
CDS:
1021..1977

Additional Resources:

NCBI RefSeq record:
NM_001354683.2
NBCI Gene record:
ZBTB25 (7597)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021295 CGCTTGTCACAAGAACACTTA pLKO.1 2151 3UTR 100% 4.950 6.930 N ZBTB25 n/a
2 TRCN0000021294 GCCGACTACCTTTCTCACATT pLKO.1 1330 CDS 100% 4.950 6.930 N ZBTB25 n/a
3 TRCN0000275885 GCCGACTACCTTTCTCACATT pLKO_005 1330 CDS 100% 4.950 6.930 N ZBTB25 n/a
4 TRCN0000021298 CCAACCTGACATATTCAGCTA pLKO.1 1224 CDS 100% 2.640 3.696 N ZBTB25 n/a
5 TRCN0000285454 CCAACCTGACATATTCAGCTA pLKO_005 1224 CDS 100% 2.640 3.696 N ZBTB25 n/a
6 TRCN0000021297 GCTTCCATTCTGGAAAGTAAT pLKO.1 1831 CDS 100% 13.200 9.240 N ZBTB25 n/a
7 TRCN0000275884 GCTTCCATTCTGGAAAGTAAT pLKO_005 1831 CDS 100% 13.200 9.240 N ZBTB25 n/a
8 TRCN0000275946 TTGGAGGAAGGGATTCGATTT pLKO_005 1303 CDS 100% 10.800 6.480 N ZBTB25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01803 pDONR223 100% 72.9% 72.4% None (many diffs) n/a
2 ccsbBroad304_01803 pLX_304 0% 72.9% 72.4% V5 (many diffs) n/a
3 TRCN0000481016 CAGCGCAGAGCACTAAGCAGGTTG pLX_317 31.6% 72.9% 72.4% V5 (many diffs) n/a
Download CSV