Construct: ORF TRCN0000481016
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006200.1_s317c1
- Derived from:
- ccsbBroadEn_01803
- DNA Barcode:
- CAGCGCAGAGCACTAAGCAGGTTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZBTB25 (7597)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481016
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | NM_001304507.1 | 100% | 100% | |
| 2 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | NM_001354684.2 | 100% | 100% | |
| 3 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | NM_001354685.2 | 100% | 100% | |
| 4 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | NM_001354686.2 | 100% | 100% | |
| 5 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | NM_001354687.1 | 100% | 100% | |
| 6 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | NM_006977.5 | 100% | 100% | |
| 7 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | XM_006720251.3 | 100% | 100% | |
| 8 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | XM_006720252.4 | 100% | 100% | |
| 9 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | XM_017021634.1 | 100% | 100% | |
| 10 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | XM_005268051.3 | 95.1% | 95.1% | 1_66del |
| 11 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | XM_017021631.1 | 95.1% | 95.1% | 1_66del |
| 12 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | NM_001354682.2 | 91.7% | 91.7% | 1_117del |
| 13 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | XM_011537146.2 | 91.7% | 91.7% | 1_117del |
| 14 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | XM_017021630.2 | 77.6% | 77.6% | 1_375del |
| 15 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | NM_001354683.2 | 72.9% | 72.4% | (many diffs) |
| 16 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | XM_006720250.4 | 67.1% | 66.6% | (many diffs) |
| 17 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | XM_017021636.1 | 66.9% | 66.4% | (many diffs) |
| 18 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | XM_011537141.3 | 56.6% | 56.2% | (many diffs) |
| 19 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | XR_943522.3 | 50.8% | (many diffs) | |
| 20 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | XM_017021638.2 | 47.4% | 26.4% | (many diffs) |
| 21 | human | 7597 | ZBTB25 | zinc finger and BTB domain ... | NM_001304508.1 | 16.6% | 12.8% | (many diffs) |
| 22 | mouse | 109929 | Zbtb25 | zinc finger and BTB domain ... | NM_001172104.1 | 89.3% | 90.8% | (many diffs) |
| 23 | mouse | 109929 | Zbtb25 | zinc finger and BTB domain ... | NM_028356.2 | 89.3% | 90.8% | (many diffs) |
| 24 | mouse | 109929 | Zbtb25 | zinc finger and BTB domain ... | XM_006515393.1 | 89.3% | 90.8% | (many diffs) |
| 25 | mouse | 109929 | Zbtb25 | zinc finger and BTB domain ... | XM_006515394.1 | 89.3% | 90.8% | (many diffs) |
| 26 | mouse | 109929 | Zbtb25 | zinc finger and BTB domain ... | XM_006515396.1 | 89.3% | 90.8% | (many diffs) |
| 27 | mouse | 109929 | Zbtb25 | zinc finger and BTB domain ... | XM_006515397.1 | 89.3% | 90.8% | (many diffs) |
| 28 | mouse | 109929 | Zbtb25 | zinc finger and BTB domain ... | XM_006515399.2 | 89.3% | 90.8% | (many diffs) |
| 29 | mouse | 109929 | Zbtb25 | zinc finger and BTB domain ... | XM_006515400.1 | 65.2% | 65.3% | (many diffs) |
| 30 | mouse | 109929 | Zbtb25 | zinc finger and BTB domain ... | XM_017314935.1 | 65.2% | 65.3% | (many diffs) |
| 31 | mouse | 109929 | Zbtb25 | zinc finger and BTB domain ... | XM_006515391.3 | 56.6% | 57.6% | (many diffs) |
| 32 | mouse | 109929 | Zbtb25 | zinc finger and BTB domain ... | XM_006515392.3 | 56.5% | 53.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1371
- ORF length:
- 1305
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cactgccagc catagccttg ttcttctcca gcagctgaac atgcagcgag 121 aatttggttt tctgtgtgat tgcacagttg caattggaga tgtttacttc aaagcccaca 181 gagcagtgct tgctgctttt tctaactatt tcaagatgat atttattcac caaacaagtg 241 aatgcataaa aatacaacca actgacatcc aacctgacat attcagctat ttgttgcaca 301 ttatgtacac ggggaaaggg ccaaaacaga ttgtggatca tagtcgtttg gaggaaggga 361 ttcgatttct tcacgccgac tacctttctc acattgcaac tgaaatgaat caagtgttct 421 caccagagac tgtgcagtcc tcaaatttat atggcattca gatctcaaca acccaaaaaa 481 cagttgtcaa acaaggactg gaggtcaaag aagctccttc cagtaacagt ggaaacagag 541 ctgctgtcca gggtgaccac ccccagttgc agttgtctct tgctattggt ctggatgatg 601 gcactgcaga ccagcagagg gcctgtcctg ccacccaggc cctggaggag caccagaagc 661 ccccagtttc catcaagcag gagagatgtg acccagaatc tgtgatctcc cagagccacc 721 cctcaccctc atcagaggtg acaggcccca cttttactga aaacagtgtc aaaatacact 781 tatgccatta ctgtggggaa cgttttgatt cccgtagtaa cctaaggcaa catctccata 841 cacatgtgtc tggatccctg ccattcggtg tccctgcttc cattctggaa agtaatgacc 901 ttggtgaagt gcatcccctt aatgaaaaca gcgaggccct tgaatgccgc aggctcagct 961 ccTTCATTGT TAAGGAGAAT GAACAGCAGC CAGACCACAC CAACCGGGGT ACCACAGAGC 1021 CTTTGCAGAT CAGTCAAGTA TCTTTGATCT CCAAAGACAC AGAGCCAGTA GAATTAAACT 1081 GTAATTTTTC TTTTTCAAGG AAAAGAAAAA TGAGCTGTAC CATCTGTGGT CATAAATTCC 1141 CTCGAAAGAG CCAATTGTTG GAACACATGT ATACACACAA AGGTAAATCT TACAGATATA 1201 ACCGATGCCA AAGGTTTGGT AATGCATTGG CCCAGAGATT TCAGCCATAC TGTGACAGCT 1261 GGTCTGATGT CTCCCTGAAA AGTTCTCGCT TGTCACAAGA ACACTTAGAC TTGCCTTGTG 1321 CCTTAGAGTC AGAGCTCACA CAAGAAAATG TGGATACTAT CCTAGTTGAG TACCCAACTT 1381 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1441 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1501 CTTGTGGAAA GGACGACAGC GCAGAGCACT AAGCAGGTTG ACGCGTTAAG TCgacaatca 1561 acctctggat tacaaaattt gtgaaagatt