Transcript: Human NM_001354699.1

Homo sapiens glycine-N-acyltransferase like 1 (GLYATL1), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-12-06
Taxon:
Homo sapiens (human)
Gene:
GLYATL1 (92292)
Length:
2701
CDS:
746..1654

Additional Resources:

NCBI RefSeq record:
NM_001354699.1
NBCI Gene record:
GLYATL1 (92292)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431527 GGCTGAGGATAATAGAGTTTC pLKO_005 689 5UTR 100% 10.800 15.120 N GLYATL1 n/a
2 TRCN0000158570 CGTATATCGTATGTTCTCCAA pLKO.1 964 CDS 100% 2.640 3.696 N GLYATL1 n/a
3 TRCN0000418945 ATGAGGCAATGGTACACTAAA pLKO_005 2089 3UTR 100% 13.200 9.240 N GLYATL1 n/a
4 TRCN0000434087 TGGTTAATAGAATCTACTATC pLKO_005 1968 3UTR 100% 10.800 7.560 N GLYATL1 n/a
5 TRCN0000158569 CCTAATCTGTATGGATACTTT pLKO.1 2034 3UTR 100% 5.625 3.938 N GLYATL1 n/a
6 TRCN0000161482 GTATGGCTCTGTGTATCACAT pLKO.1 826 CDS 100% 4.950 3.465 N GLYATL1 n/a
7 TRCN0000160333 CTCTTGGTTACGGAAGATATT pLKO.1 1139 CDS 100% 13.200 7.920 N GLYATL1 n/a
8 TRCN0000160615 CGTCAGAAGAATATTCCATTT pLKO.1 1511 CDS 100% 10.800 6.480 N GLYATL1 n/a
9 TRCN0000163005 GCAGGAGATGACTGATGACAT pLKO.1 928 CDS 100% 4.950 2.970 N GLYATL1 n/a
10 TRCN0000161403 GCTGGTAAATGACAACTGGAA pLKO.1 1285 CDS 100% 2.640 1.320 Y GLYATL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12978 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12978 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467461 CTATAATGACTTACACCTCTTTTA pLX_317 48.5% 100% 100% V5 n/a
Download CSV