Transcript: Human NM_001354717.2

Homo sapiens alpha fetoprotein (AFP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
AFP (174)
Length:
2284
CDS:
375..1730

Additional Resources:

NCBI RefSeq record:
NM_001354717.2
NBCI Gene record:
AFP (174)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354717.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371234 GCTGACCTGGCTACCATATTT pLKO_005 172 5UTR 100% 15.000 10.500 N AFP n/a
2 TRCN0000371231 TTTGGAGAAGTACGGACATTC pLKO_005 354 5UTR 100% 10.800 7.560 N AFP n/a
3 TRCN0000056859 CCTGCCTTTCTGGAAGAACTT pLKO.1 316 5UTR 100% 4.950 3.465 N AFP n/a
4 TRCN0000056860 CCTTCCTGTATGCACCTACAA pLKO.1 412 CDS 100% 4.950 3.465 N AFP n/a
5 TRCN0000056858 CCCTCTTGAATGCCAAGATAA pLKO.1 1067 CDS 100% 1.320 0.924 N AFP n/a
6 TRCN0000056861 CCATATTGGATTCTTACCAAT pLKO.1 131 5UTR 100% 0.495 0.347 N AFP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354717.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00036 pDONR223 100% 74% 74% None 0_1ins474;1167A>G n/a
2 ccsbBroad304_00036 pLX_304 0% 74% 74% V5 0_1ins474;1167A>G n/a
3 TRCN0000470938 CCGGTGGTCCTATCTCACACCTTT pLX_317 25.7% 74% 74% V5 0_1ins474;1167A>G n/a
Download CSV