Transcript: Human NM_001354994.1

Homo sapiens iron responsive element binding protein 2 (IREB2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
IREB2 (3658)
Length:
6477
CDS:
444..3164

Additional Resources:

NCBI RefSeq record:
NM_001354994.1
NBCI Gene record:
IREB2 (3658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438740 ACGGAGCTCGAAGAGGTAATG pLKO_005 2623 CDS 100% 10.800 15.120 N IREB2 n/a
2 TRCN0000056602 CCACCCTTAGTGGTAGCTTAT pLKO.1 2157 CDS 100% 10.800 15.120 N IREB2 n/a
3 TRCN0000056598 GCAGGAAGTATCGCTAGGAAT pLKO.1 2544 CDS 100% 4.950 6.930 N IREB2 n/a
4 TRCN0000114440 GTACGAAATTGTGATGGCTTT pLKO.1 420 5UTR 100% 4.050 5.670 N Ireb2 n/a
5 TRCN0000334352 GTACGAAATTGTGATGGCTTT pLKO_005 420 5UTR 100% 4.050 5.670 N Ireb2 n/a
6 TRCN0000429419 GAAGGTATCCCACTGATTATT pLKO_005 2781 CDS 100% 15.000 10.500 N IREB2 n/a
7 TRCN0000423746 GGCCATTGGAATCTCATTTAT pLKO_005 3599 3UTR 100% 15.000 10.500 N IREB2 n/a
8 TRCN0000423091 TATACGAATGGTGCTATTAAT pLKO_005 3344 3UTR 100% 15.000 10.500 N IREB2 n/a
9 TRCN0000056600 CCTCAGTTCAAGTGGAGTATT pLKO.1 1940 CDS 100% 13.200 9.240 N IREB2 n/a
10 TRCN0000415021 GCAAACATGTGTCCGGAATAT pLKO_005 1386 CDS 100% 13.200 9.240 N IREB2 n/a
11 TRCN0000430945 GGAAGCTGCTGTACGAAATTG pLKO_005 410 5UTR 100% 13.200 9.240 N IREB2 n/a
12 TRCN0000424711 TACTACTGTTTGTTGGTTTAA pLKO_005 3531 3UTR 100% 13.200 9.240 N IREB2 n/a
13 TRCN0000056599 GCTGGAAAGTTTGTTGAGTTT pLKO.1 1317 CDS 100% 4.950 3.465 N IREB2 n/a
14 TRCN0000056601 GCCCGTGTTCTTCTTCAAGAT pLKO.1 519 CDS 100% 4.950 2.970 N IREB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15485 pDONR223 0% 29.6% 29.4% None (many diffs) n/a
2 ccsbBroad304_15485 pLX_304 0% 29.6% 29.4% V5 (many diffs) n/a
3 TRCN0000481134 AGGAGTCATAAACATACAACGTTA pLX_317 38.8% 29.6% 29.4% V5 (many diffs) n/a
Download CSV