Transcript: Human NM_001355121.2

Homo sapiens replication protein A1 (RPA1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RPA1 (6117)
Length:
4670
CDS:
90..1763

Additional Resources:

NCBI RefSeq record:
NM_001355121.2
NBCI Gene record:
RPA1 (6117)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001355121.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010985 GCGGCTACAAAGCGTTTCTTT pLKO.1 2458 3UTR 100% 5.625 7.875 N RPA1 n/a
2 TRCN0000318753 GCGGCTACAAAGCGTTTCTTT pLKO_005 2458 3UTR 100% 5.625 7.875 N RPA1 n/a
3 TRCN0000010983 CCCTAGAACTGGTTGACGAAA pLKO.1 757 CDS 100% 4.950 6.930 N RPA1 n/a
4 TRCN0000318750 CCCTAGAACTGGTTGACGAAA pLKO_005 757 CDS 100% 4.950 6.930 N RPA1 n/a
5 TRCN0000220585 GTCATCAACATCCGTCCCATT pLKO.1 168 CDS 100% 4.050 3.240 N RPA1 n/a
6 TRCN0000010982 CGTGCTGTCTTCAAGCACTAT pLKO.1 1265 CDS 100% 0.495 0.347 N RPA1 n/a
7 TRCN0000318751 CGTGCTGTCTTCAAGCACTAT pLKO_005 1265 CDS 100% 0.495 0.347 N RPA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355121.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10443 pDONR223 100% 90.3% 90.2% None 1056C>T;1374_1375ins177;1669A>G n/a
2 ccsbBroad304_10443 pLX_304 0% 90.3% 90.2% V5 1056C>T;1374_1375ins177;1669A>G n/a
3 TRCN0000467807 GTATTAAGTAACAAAGCAAAACAT pLX_317 26.8% 90.3% 90.2% V5 1056C>T;1374_1375ins177;1669A>G n/a
Download CSV