Transcript: Human NM_001355221.1

Homo sapiens tubulin alpha 4b (TUBA4B), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
TUBA4B (80086)
Length:
1389
CDS:
166..891

Additional Resources:

NCBI RefSeq record:
NM_001355221.1
NBCI Gene record:
TUBA4B (80086)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001355221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117104 GCATGGCACATACCGCCAGAT pLKO.1 219 CDS 100% 1.350 1.890 N TUBA4B n/a
2 TRCN0000117102 CCACAGGCTTTAAGGTTGATA pLKO.1 1024 3UTR 100% 5.625 3.938 N TUBA4B n/a
3 TRCN0000117103 CATTCCTGATGGAGTGGCTTT pLKO.1 434 CDS 100% 4.050 2.835 N TUBA4B n/a
4 TRCN0000117106 GCCTTCATGGTGGACAACAAA pLKO.1 583 CDS 100% 5.625 3.375 N TUBA4B n/a
5 TRCN0000117105 CCAACCTCAATCGCCTCATTA pLKO.1 656 CDS 100% 13.200 6.600 Y TUBA4B n/a
6 TRCN0000029140 GCAAGGAAGATGCTGCCAATA pLKO.1 266 CDS 100% 10.800 5.400 Y TUBA1C n/a
7 TRCN0000349678 GCAAGGAAGATGCTGCCAATA pLKO_005 266 CDS 100% 10.800 5.400 Y TUBA1C n/a
8 TRCN0000153763 CCACAAGTTTGACCTGATGTA pLKO.1 1156 3UTR 100% 4.950 2.475 Y TUBA1B n/a
9 TRCN0000319311 CCACAAGTTTGACCTGATGTA pLKO_005 1156 3UTR 100% 4.950 2.475 Y TUBA1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07108 pDONR223 100% 49.4% 34.2% None (many diffs) n/a
2 ccsbBroad304_07108 pLX_304 0% 49.4% 34.2% V5 (many diffs) n/a
3 TRCN0000467865 AGTTCGTGAAACATACGCCGGCAG pLX_317 34.6% 49.4% 34.2% V5 (many diffs) n/a
Download CSV