Transcript: Mouse NM_001358550.1

Mus musculus small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha (Sgta), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Mus musculus (mouse)
Gene:
Sgta (52551)
Length:
2081
CDS:
181..1125

Additional Resources:

NCBI RefSeq record:
NM_001358550.1
NBCI Gene record:
Sgta (52551)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001358550.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190912 CCATCAGCCAATCCTAACTTT pLKO.1 1650 3UTR 100% 5.625 3.938 N Sgta n/a
2 TRCN0000293134 CCATCAGCCAATCCTAACTTT pLKO_005 1650 3UTR 100% 5.625 3.938 N Sgta n/a
3 TRCN0000189876 CCCTGACAACGACACATACAA pLKO.1 747 CDS 100% 5.625 3.938 N Sgta n/a
4 TRCN0000293131 CCCTGACAACGACACATACAA pLKO_005 747 CDS 100% 5.625 3.938 N Sgta n/a
5 TRCN0000189716 GCCACCAGAACCATCTTTGTT pLKO.1 1806 3UTR 100% 5.625 3.938 N Sgta n/a
6 TRCN0000345996 GCCACCAGAACCATCTTTGTT pLKO_005 1806 3UTR 100% 5.625 3.938 N Sgta n/a
7 TRCN0000189473 CCTCCTAAAGGGACTTGAGTA pLKO.1 1437 3UTR 100% 4.950 3.465 N Sgta n/a
8 TRCN0000190560 GCTGTCTACTTCTGTAACAGA pLKO.1 553 CDS 100% 3.000 2.100 N Sgta n/a
9 TRCN0000293068 GCTGTCTACTTCTGTAACAGA pLKO_005 553 CDS 100% 3.000 2.100 N Sgta n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001358550.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01528 pDONR223 100% 82.7% 88.5% None (many diffs) n/a
2 ccsbBroad304_01528 pLX_304 0% 82.7% 88.5% V5 (many diffs) n/a
Download CSV