Transcript: Human NM_001358664.2

Homo sapiens glutathione S-transferase theta 4 (GSTT4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
GSTT4 (25774)
Length:
964
CDS:
98..823

Additional Resources:

NCBI RefSeq record:
NM_001358664.2
NBCI Gene record:
GSTT4 (25774)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001358664.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147904 GCCTCAAAGATGGGAAATTTA pLKO.1 264 CDS 100% 15.000 7.500 Y GSTT4 n/a
2 TRCN0000146665 CATCCAGTTCAACTTTCAGTT pLKO.1 172 CDS 100% 4.950 2.475 Y GSTT4 n/a
3 TRCN0000148835 CTTCTCGAAGAAGCATGACAT pLKO.1 154 CDS 100% 4.950 2.475 Y GSTT4 n/a
4 TRCN0000147785 GATTCAATGGTCAAGGAGAAT pLKO.1 773 CDS 100% 4.950 2.475 Y GSTT4 n/a
5 TRCN0000146333 CAACTTTCAGTTTGTGGATCT pLKO.1 181 CDS 100% 4.050 2.025 Y GSTT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001358664.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10501 pDONR223 100% 27.6% 27.3% None (many diffs) n/a
2 ccsbBroad304_10501 pLX_304 0% 27.6% 27.3% V5 (many diffs) n/a
3 TRCN0000465251 ACATGAAGGACGGCGCTCCTATCG pLX_317 100% 27.6% 27.3% V5 (many diffs) n/a
Download CSV