Transcript: Human NM_001362792.2

Homo sapiens eukaryotic translation initiation factor 3 subunit B (EIF3B), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
EIF3B (8662)
Length:
2799
CDS:
615..2243

Additional Resources:

NCBI RefSeq record:
NM_001362792.2
NBCI Gene record:
EIF3B (8662)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001362792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155603 CCCAGGGTGTTGTCACAAATT pLKO.1 1408 CDS 100% 13.200 18.480 N EIF3B n/a
2 TRCN0000280904 CCCAGGGTGTTGTCACAAATT pLKO_005 1408 CDS 100% 13.200 18.480 N EIF3B n/a
3 TRCN0000152403 CAACGGGAAGATTGAACTCAT pLKO.1 1586 CDS 100% 4.950 6.930 N EIF3B n/a
4 TRCN0000156037 CGACCGACTTGAGAAACTCAA pLKO.1 389 5UTR 100% 4.950 6.930 N EIF3B n/a
5 TRCN0000297918 CGACCGACTTGAGAAACTCAA pLKO_005 389 5UTR 100% 4.950 6.930 N EIF3B n/a
6 TRCN0000152381 GCATCTATGAAACTCCTTCTA pLKO.1 1138 CDS 100% 4.950 6.930 N EIF3B n/a
7 TRCN0000155843 CGAGTGGGATATTCCAGAGAA pLKO.1 629 CDS 100% 4.950 3.960 N EIF3B n/a
8 TRCN0000096912 CGGGAAGATTGAACTCATCAA pLKO.1 1589 CDS 100% 4.950 3.960 N Eif3b n/a
9 TRCN0000153861 CGGGAAGATTGAACTCATCAA pLKO.1 1589 CDS 100% 4.950 3.960 N EIF3B n/a
10 TRCN0000297919 CGGGAAGATTGAACTCATCAA pLKO_005 1589 CDS 100% 4.950 3.960 N EIF3B n/a
11 TRCN0000155690 CCTTAGCGTTTGTGGACACTT pLKO.1 1699 CDS 100% 4.950 3.465 N EIF3B n/a
12 TRCN0000280902 CCTTAGCGTTTGTGGACACTT pLKO_005 1699 CDS 100% 4.950 3.465 N EIF3B n/a
13 TRCN0000155723 CGGAGACTACTTGTGTGTGAA pLKO.1 1364 CDS 100% 4.950 3.465 N EIF3B n/a
14 TRCN0000280903 CGGAGACTACTTGTGTGTGAA pLKO_005 1364 CDS 100% 4.950 3.465 N EIF3B n/a
15 TRCN0000152844 GAGTGGGATATTCCAGAGAAA pLKO.1 630 CDS 100% 4.950 3.465 N EIF3B n/a
16 TRCN0000154572 GATTCTGCCATTGCGACACAT pLKO.1 2433 3UTR 100% 4.950 3.465 N EIF3B n/a
17 TRCN0000154878 CGAGGAAGAATTACTGGGAGA pLKO.1 290 5UTR 100% 2.160 1.512 N EIF3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.