Transcript: Human NM_001362795.1

Homo sapiens Tax1 binding protein 1 (TAX1BP1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TAX1BP1 (8887)
Length:
3179
CDS:
183..2231

Additional Resources:

NCBI RefSeq record:
NM_001362795.1
NBCI Gene record:
TAX1BP1 (8887)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001362795.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330602 GGAGTACTGCTCGTGATTATT pLKO_005 352 CDS 100% 15.000 21.000 N TAX1BP1 n/a
2 TRCN0000330601 TCAGATCAATCAGCTAATAAT pLKO_005 1581 CDS 100% 15.000 21.000 N TAX1BP1 n/a
3 TRCN0000353684 TGAAGTAGTTCTTCGAATATA pLKO_005 2670 3UTR 100% 15.000 21.000 N TAX1BP1 n/a
4 TRCN0000130349 GTTACCCATAAGGGTGAAATT pLKO.1 495 CDS 100% 13.200 18.480 N TAX1BP1 n/a
5 TRCN0000130449 GTCAGTCTTTGGCTTATCAAT pLKO.1 2394 3UTR 100% 5.625 4.500 N TAX1BP1 n/a
6 TRCN0000330552 TTACACCTTAACTCCATATAT pLKO_005 287 CDS 100% 15.000 10.500 N TAX1BP1 n/a
7 TRCN0000149268 GATGCTTTCATGCACCCTTTA pLKO.1 2322 3UTR 100% 10.800 7.560 N TAX1BP1 n/a
8 TRCN0000177717 CCAGCTTTGATGTTCACAAGA pLKO.1 2026 CDS 100% 4.950 3.465 N Tax1bp1 n/a
9 TRCN0000130429 GCACAACATGAAAGAGAACAA pLKO.1 966 CDS 100% 4.950 3.465 N TAX1BP1 n/a
10 TRCN0000330600 GCACAACATGAAAGAGAACAA pLKO_005 966 CDS 100% 4.950 3.465 N TAX1BP1 n/a
11 TRCN0000148051 GCTACTTTGAGTTTGGTGTTA pLKO.1 2362 3UTR 100% 4.950 3.465 N TAX1BP1 n/a
12 TRCN0000128840 GCTCGTGATTATTACACGTTT pLKO.1 360 CDS 100% 4.950 3.465 N TAX1BP1 n/a
13 TRCN0000147602 GTTTCTGTTGACCTTGTTGAT pLKO.1 2595 3UTR 100% 4.950 3.465 N TAX1BP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362795.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07325 pDONR223 100% 86.3% 86.1% None 919T>A;1175A>G;1761_1762ins321 n/a
2 ccsbBroad304_07325 pLX_304 0% 86.3% 86.1% V5 919T>A;1175A>G;1761_1762ins321 n/a
Download CSV