Transcript: Mouse NM_001363025.1

Mus musculus tripartite motif-containing 37 (Trim37), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-27
Taxon:
Mus musculus (mouse)
Gene:
Trim37 (68729)
Length:
3551
CDS:
400..3426

Additional Resources:

NCBI RefSeq record:
NM_001363025.1
NBCI Gene record:
Trim37 (68729)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001363025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221062 CCACAGCATCATATTCTCGAA pLKO.1 2345 CDS 100% 2.640 3.696 N TRIM37 n/a
2 TRCN0000040787 CTCTGGTAGATTACAGGATTT pLKO.1 2586 CDS 100% 10.800 8.640 N Trim37 n/a
3 TRCN0000040786 GCTGGACTTGTAAGAAGTGTA pLKO.1 716 CDS 100% 4.950 3.960 N Trim37 n/a
4 TRCN0000316541 GCTGGACTTGTAAGAAGTGTA pLKO_005 716 CDS 100% 4.950 3.960 N Trim37 n/a
5 TRCN0000221058 CCACCAGACTTTACCAGTGAA pLKO.1 1192 CDS 100% 4.950 3.465 N TRIM37 n/a
6 TRCN0000040784 GCACTGGTATATTACTCAGTT pLKO.1 1644 CDS 100% 4.950 3.465 N Trim37 n/a
7 TRCN0000349178 GCACTGGTATATTACTCAGTT pLKO_005 1644 CDS 100% 4.950 3.465 N Trim37 n/a
8 TRCN0000040785 GCAGCTCTTCTGCTAGTTCTA pLKO.1 2003 CDS 100% 4.950 3.465 N Trim37 n/a
9 TRCN0000349176 GCAGCTCTTCTGCTAGTTCTA pLKO_005 2003 CDS 100% 4.950 3.465 N Trim37 n/a
10 TRCN0000040783 GCTTAGTTCAAGAAGTGGAAA pLKO.1 875 CDS 100% 4.950 2.970 N Trim37 n/a
11 TRCN0000349177 GCTTAGTTCAAGAAGTGGAAA pLKO_005 875 CDS 100% 4.950 2.970 N Trim37 n/a
12 TRCN0000140258 GAAGATGAAGATGAGGAGGGA pLKO.1 1888 CDS 100% 0.660 0.330 Y MEA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06605 pDONR223 100% 84.3% 88% None (many diffs) n/a
2 ccsbBroad304_06605 pLX_304 0% 84.3% 88% V5 (many diffs) n/a
3 TRCN0000473990 TAGAACAAAGCACACACGATGAAC pLX_317 8.9% 84.3% 88% V5 (many diffs) n/a
Download CSV