Transcript: Human NM_001363069.2

Homo sapiens cell cycle and apoptosis regulator 2 (CCAR2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
CCAR2 (57805)
Length:
4725
CDS:
125..2893

Additional Resources:

NCBI RefSeq record:
NM_001363069.2
NBCI Gene record:
CCAR2 (57805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363069.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342192 CCAGCTTGCATGACTACTTTG pLKO_005 312 CDS 100% 10.800 15.120 N Ccar2 n/a
2 TRCN0000053726 CGGGTCTTCACTGGTATTGTT pLKO.1 290 CDS 100% 5.625 7.875 N CCAR2 n/a
3 TRCN0000290846 CGGGTCTTCACTGGTATTGTT pLKO_005 290 CDS 100% 5.625 7.875 N CCAR2 n/a
4 TRCN0000053724 GCATTGATTTGAGCGGCTGTA pLKO.1 1302 CDS 100% 4.050 3.240 N CCAR2 n/a
5 TRCN0000290848 GCATTGATTTGAGCGGCTGTA pLKO_005 1302 CDS 100% 4.050 3.240 N CCAR2 n/a
6 TRCN0000053723 CCTCTGAAGCAGATTAAGTTT pLKO.1 1148 CDS 100% 5.625 3.938 N CCAR2 n/a
7 TRCN0000290849 CCTCTGAAGCAGATTAAGTTT pLKO_005 1148 CDS 100% 5.625 3.938 N CCAR2 n/a
8 TRCN0000053727 CCCATCTGTGACTTCCTAGAA pLKO.1 830 CDS 100% 4.950 3.465 N CCAR2 n/a
9 TRCN0000290850 CCCATCTGTGACTTCCTAGAA pLKO_005 830 CDS 100% 4.950 3.465 N CCAR2 n/a
10 TRCN0000053725 GCCAAAGGAAAGGATCTCTTT pLKO.1 1708 CDS 100% 4.950 3.465 N CCAR2 n/a
11 TRCN0000290847 GCCAAAGGAAAGGATCTCTTT pLKO_005 1708 CDS 100% 4.950 3.465 N CCAR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363069.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12406 pDONR223 100% 39.4% 39.4% None 1_1674del;1989_1990insGCA n/a
2 ccsbBroad304_12406 pLX_304 0% 39.4% 39.4% V5 1_1674del;1989_1990insGCA n/a
3 TRCN0000472079 GCCGTGTAGCGTAACTGGAACGGG pLX_317 30.2% 39.4% 39.4% V5 1_1674del;1989_1990insGCA n/a
Download CSV