Transcript: Human NM_001363088.1

Homo sapiens junctional cadherin complex regulator (JHY), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
JHY (79864)
Length:
3034
CDS:
535..2757

Additional Resources:

NCBI RefSeq record:
NM_001363088.1
NBCI Gene record:
JHY (79864)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271410 CAAAGTCCTTCACATCGTATA pLKO_005 2736 CDS 100% 10.800 15.120 N JHY n/a
2 TRCN0000136518 CCTATACTGTCAAGGGTAGAA pLKO.1 2203 CDS 100% 4.950 6.930 N JHY n/a
3 TRCN0000136324 CGCAAGAGATTATGTGCCATT pLKO.1 686 CDS 100% 4.050 5.670 N JHY n/a
4 TRCN0000284375 CTCAGTTTGTTTATCACATAA pLKO_005 1952 CDS 100% 13.200 9.240 N JHY n/a
5 TRCN0000284373 CTGTCCTTCATACCAACTTAA pLKO_005 578 CDS 100% 13.200 9.240 N JHY n/a
6 TRCN0000134766 GTTGAGAGTAATGGCCTATTA pLKO.1 2836 3UTR 100% 13.200 9.240 N JHY n/a
7 TRCN0000136960 CGGCGAAGGAAATCCAAACAA pLKO.1 1273 CDS 100% 5.625 3.938 N JHY n/a
8 TRCN0000134175 CCATCAAATCTGACTCATCAA pLKO.1 2596 CDS 100% 4.950 3.465 N JHY n/a
9 TRCN0000136817 CCCAACTCAGTTCAGAGAGAA pLKO.1 2231 CDS 100% 4.950 3.465 N JHY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14273 pDONR223 100% 33.4% 31.5% None (many diffs) n/a
2 ccsbBroad304_14273 pLX_304 0% 33.4% 31.5% V5 (many diffs) n/a
3 TRCN0000473635 CTGCGACGCGGTACTGACGAATAT pLX_317 70.7% 33.4% 31.5% V5 (many diffs) n/a
Download CSV