Transcript: Human NM_001363487.1

Homo sapiens yippee like 4 (YPEL4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-28
Taxon:
Homo sapiens (human)
Gene:
YPEL4 (219539)
Length:
1914
CDS:
637..1020

Additional Resources:

NCBI RefSeq record:
NM_001363487.1
NBCI Gene record:
YPEL4 (219539)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363487.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138349 CAAGACTTTCCGCAGCTATCT pLKO.1 681 CDS 100% 4.950 6.930 N YPEL4 n/a
2 TRCN0000138054 CCTGTTTAACTCCGTGGTCAA pLKO.1 807 CDS 100% 4.050 5.670 N YPEL4 n/a
3 TRCN0000138010 GTTTAACTCCGTGGTCAACGT pLKO.1 810 CDS 100% 2.640 3.696 N YPEL4 n/a
4 TRCN0000134295 GAAGTACAAGGAAGGGAAATA pLKO.1 954 CDS 100% 13.200 9.240 N YPEL4 n/a
5 TRCN0000174533 CTTATTTCCAAGTCCTTCCAA pLKO.1 766 CDS 100% 3.000 2.100 N Ypel4 n/a
6 TRCN0000135494 GCTGGAAATATGAGCAAGCTT pLKO.1 920 CDS 100% 3.000 2.100 N YPEL4 n/a
7 TRCN0000133919 CATTGAAATGTCACACATGGT pLKO.1 978 CDS 100% 2.640 1.848 N YPEL4 n/a
8 TRCN0000138562 CCACAGAACAGCAGATGAGAA pLKO.1 1424 3UTR 100% 4.950 2.970 N YPEL4 n/a
9 TRCN0000138485 CCAGAAGTACAAGGAAGGGAA pLKO.1 951 CDS 100% 2.640 1.584 N YPEL4 n/a
10 TRCN0000190584 GCTGGAAATATGAGCAAGCCT pLKO.1 920 CDS 100% 0.750 0.525 N Ypel3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363487.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05224 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05224 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480392 CACCTCCTCGTGTCCAACACTACT pLX_317 92% 100% 100% V5 n/a
Download CSV