Transcript: Human NM_001363513.1

Homo sapiens mitochondrial calcium uptake 1 (MICU1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
MICU1 (10367)
Length:
2501
CDS:
184..1632

Additional Resources:

NCBI RefSeq record:
NM_001363513.1
NBCI Gene record:
MICU1 (10367)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053369 CGATCCATAACACCCAATGAA pLKO.1 643 CDS 100% 5.625 4.500 N MICU1 n/a
2 TRCN0000299802 CGATCCATAACACCCAATGAA pLKO_005 643 CDS 100% 5.625 4.500 N MICU1 n/a
3 TRCN0000053370 GCAATGGCGAACTGAGCAATA pLKO.1 1472 CDS 100% 10.800 7.560 N MICU1 n/a
4 TRCN0000299804 GCAATGGCGAACTGAGCAATA pLKO_005 1472 CDS 100% 10.800 7.560 N MICU1 n/a
5 TRCN0000053371 CATCGGTGATAAAGGGAAGAA pLKO.1 390 CDS 100% 4.950 3.465 N MICU1 n/a
6 TRCN0000299736 CATCGGTGATAAAGGGAAGAA pLKO_005 390 CDS 100% 4.950 3.465 N MICU1 n/a
7 TRCN0000053372 CTTCGCTTTACCCAAACAGTA pLKO.1 1611 CDS 100% 4.950 3.465 N MICU1 n/a
8 TRCN0000053368 GCAGCTCAAGAAGCACTTCAA pLKO.1 1242 CDS 100% 4.950 3.465 N MICU1 n/a
9 TRCN0000299805 GCAGCTCAAGAAGCACTTCAA pLKO_005 1242 CDS 100% 4.950 3.465 N MICU1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02410 pDONR223 100% 98.7% 98.7% None 536_553del n/a
2 ccsbBroad304_02410 pLX_304 0% 98.7% 98.7% V5 536_553del n/a
3 TRCN0000481335 GGATATCGAACGTTACCCATTGAG pLX_317 30.3% 98.7% 98.7% V5 536_553del n/a
Download CSV