Transcript: Human NM_001363543.2

Homo sapiens centrosomal protein 126 (CEP126), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CEP126 (57562)
Length:
7730
CDS:
1555..4311

Additional Resources:

NCBI RefSeq record:
NM_001363543.2
NBCI Gene record:
CEP126 (57562)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363543.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134870 CGACATTATATTGCACCCAAA pLKO.1 3665 CDS 100% 4.050 5.670 N CEP126 n/a
2 TRCN0000134375 GCATTCTCAACAATTCCACAT pLKO.1 2931 CDS 100% 4.050 5.670 N CEP126 n/a
3 TRCN0000134608 GAGCCACAAATACTGCTAATA pLKO.1 2033 CDS 100% 13.200 10.560 N CEP126 n/a
4 TRCN0000138086 GCACCCAAAGAAGTCCTGTTT pLKO.1 3677 CDS 100% 4.950 3.960 N CEP126 n/a
5 TRCN0000133995 CCCTGTACATGATGATTCTAA pLKO.1 3165 CDS 100% 5.625 3.938 N CEP126 n/a
6 TRCN0000135548 GCAGCAATAGAGCAAAGGTTA pLKO.1 4818 3UTR 100% 4.950 3.465 N CEP126 n/a
7 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 6664 3UTR 100% 4.950 2.475 Y ORAI2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4992 3UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 6661 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363543.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14233 pDONR223 100% 82% 47.6% None (many diffs) n/a
2 ccsbBroad304_14233 pLX_304 0% 82% 47.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000472889 AAAAGGGGCCAAGTGGTGGGCACG pLX_317 10.7% 82% 47.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV