Transcript: Human NM_001363574.2

Homo sapiens 15-hydroxyprostaglandin dehydrogenase (HPGD), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
HPGD (3248)
Length:
1899
CDS:
38..568

Additional Resources:

NCBI RefSeq record:
NM_001363574.2
NBCI Gene record:
HPGD (3248)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363574.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000197 GAAGGCGGCATCATTATCAAT pLKO.1 422 CDS 100% 5.625 4.500 N HPGD n/a
2 TRCN0000000195 GCTGGAGTGAATAATGAGAAA pLKO.1 311 CDS 100% 4.950 3.960 N HPGD n/a
3 TRCN0000000196 GCAACAACTGAGAGACACTTT pLKO.1 241 CDS 100% 4.950 3.465 N HPGD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363574.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00782 pDONR223 100% 59.5% 54% None (many diffs) n/a
2 ccsbBroad304_00782 pLX_304 0% 59.5% 54% V5 (many diffs) n/a
3 TRCN0000468979 TTAATATCGTTATTTACTAACGCA pLX_317 52.6% 59.5% 54% V5 (many diffs) n/a
Download CSV