Transcript: Human NM_001363703.2

Homo sapiens glutathione S-transferase zeta 1 (GSTZ1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
GSTZ1 (2954)
Length:
1122
CDS:
67..720

Additional Resources:

NCBI RefSeq record:
NM_001363703.2
NBCI Gene record:
GSTZ1 (2954)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363703.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036122 CGTGCGTATGATTTCTGACCT pLKO.1 363 CDS 100% 2.640 3.696 N GSTZ1 n/a
2 TRCN0000300628 CGTGCGTATGATTTCTGACCT pLKO_005 363 CDS 100% 2.640 3.696 N GSTZ1 n/a
3 TRCN0000036121 ACAGCGGGCATATACTGTGTA pLKO.1 514 CDS 100% 4.950 3.465 N GSTZ1 n/a
4 TRCN0000300625 ACAGCGGGCATATACTGTGTA pLKO_005 514 CDS 100% 4.950 3.465 N GSTZ1 n/a
5 TRCN0000036120 GCAGAACCTGTCTGTCCTGAA pLKO.1 408 CDS 100% 4.050 2.835 N GSTZ1 n/a
6 TRCN0000300627 GCAGAACCTGTCTGTCCTGAA pLKO_005 408 CDS 100% 4.050 2.835 N GSTZ1 n/a
7 TRCN0000036119 GCTGAAAGATTCAAGGTGGAT pLKO.1 586 CDS 100% 2.640 1.848 N GSTZ1 n/a
8 TRCN0000300689 GCTGAAAGATTCAAGGTGGAT pLKO_005 586 CDS 100% 2.640 1.848 N GSTZ1 n/a
9 TRCN0000036123 GCAGCCAGATACACCCACTGA pLKO.1 687 CDS 100% 0.880 0.616 N GSTZ1 n/a
10 TRCN0000300624 GCAGCCAGATACACCCACTGA pLKO_005 687 CDS 100% 0.880 0.616 N GSTZ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363703.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00704 pDONR223 100% 98.9% 98.1% None (many diffs) n/a
2 ccsbBroad304_00704 pLX_304 0% 98.9% 98.1% V5 (many diffs) n/a
3 TRCN0000472290 CGCTCCGATCACATACCGGGAGTC pLX_317 71.1% 98.9% 98.1% V5 (many diffs) n/a
Download CSV