Transcript: Human NM_001363766.1

Homo sapiens crystallin alpha A (CRYAA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CRYAA (1409)
Length:
1037
CDS:
97..507

Additional Resources:

NCBI RefSeq record:
NM_001363766.1
NBCI Gene record:
CRYAA (1409)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363766.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083360 CGTCATCTTCCTCGATGTGAA pLKO.1 198 CDS 100% 4.950 2.475 Y CRYAA n/a
2 TRCN0000083359 CTTTGTGGAGATCCACGGAAA pLKO.1 261 CDS 100% 4.050 2.025 Y CRYAA n/a
3 TRCN0000083358 TCTCACATGGAATGAGGGTTT pLKO.1 616 3UTR 100% 4.050 2.025 Y CRYAA n/a
4 TRCN0000412249 CCTCGTCCTAAGCAGGCATTG pLKO_005 497 CDS 100% 2.000 1.000 Y CRYAA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363766.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06041 pDONR223 100% 70.4% 64.4% None (many diffs) n/a
2 ccsbBroad304_06041 pLX_304 0% 70.4% 64.4% V5 (many diffs) n/a
3 TRCN0000480659 AAGCCGCATAGACGGGATTCGCCG pLX_317 66% 70.4% 64.4% V5 (many diffs) n/a
Download CSV