Transcript: Human NM_001363883.1

Homo sapiens solute carrier family 33 member 1 (SLC33A1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
SLC33A1 (9197)
Length:
2633
CDS:
410..1753

Additional Resources:

NCBI RefSeq record:
NM_001363883.1
NBCI Gene record:
SLC33A1 (9197)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363883.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310223 GGACTCTTCATGATCTATTTA pLKO_005 863 CDS 100% 15.000 21.000 N SLC33A1 n/a
2 TRCN0000296497 TACAGCCCTGGATGGTTATTA pLKO_005 1615 CDS 100% 15.000 21.000 N SLC33A1 n/a
3 TRCN0000042920 GAATCGTTACTCTTTCAGATT pLKO.1 1167 CDS 100% 4.950 6.930 N SLC33A1 n/a
4 TRCN0000289985 GAATCGTTACTCTTTCAGATT pLKO_005 1167 CDS 100% 4.950 6.930 N SLC33A1 n/a
5 TRCN0000310222 ATCAGTGCACAGGAGTATAAA pLKO_005 1820 3UTR 100% 15.000 10.500 N SLC33A1 n/a
6 TRCN0000296496 AGGTTAGTGATCCACTTATTG pLKO_005 1416 CDS 100% 13.200 9.240 N SLC33A1 n/a
7 TRCN0000042918 GCCTCTGATTATCAGCAAATA pLKO.1 1298 CDS 100% 13.200 9.240 N SLC33A1 n/a
8 TRCN0000042921 CTACTCTTTCTTTACGTGCTT pLKO.1 641 CDS 100% 2.640 1.848 N SLC33A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363883.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02104 pDONR223 100% 81.4% 73.9% None 773_774ins188;957_958ins118 n/a
2 ccsbBroad304_02104 pLX_304 0% 81.4% 73.9% V5 773_774ins188;957_958ins118 n/a
3 TRCN0000474996 TTTTATCCTGCCAGCTCTTGTGTT pLX_317 3.7% 81.4% 73.9% V5 773_774ins188;957_958ins118 n/a
Download CSV