Transcript: Human NM_001363912.1

Homo sapiens hydroxyacylglutathione hydrolase (HAGH), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
HAGH (3029)
Length:
1583
CDS:
408..1328

Additional Resources:

NCBI RefSeq record:
NM_001363912.1
NBCI Gene record:
HAGH (3029)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363912.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050834 ACTGCGGATGAGATGTGTAAA pLKO.1 993 CDS 100% 13.200 9.240 N HAGH n/a
2 TRCN0000234893 ACTGCGGATGAGATGTGTAAA pLKO_005 993 CDS 100% 13.200 9.240 N HAGH n/a
3 TRCN0000234890 ATGCTGGCGGGAATGAGAAAC pLKO_005 727 CDS 100% 10.800 7.560 N HAGH n/a
4 TRCN0000234891 CCACACTTCAGGACACATTTG pLKO_005 878 CDS 100% 10.800 7.560 N HAGH n/a
5 TRCN0000234892 TCACAGGTGACACCTTGTTTG pLKO_005 943 CDS 100% 10.800 7.560 N HAGH n/a
6 TRCN0000050837 CCACCCTGGCAGAGGAGTTTA pLKO.1 1189 CDS 100% 4.400 3.080 N HAGH n/a
7 TRCN0000050833 CGGGAATGAGAAACTGGTCAA pLKO.1 734 CDS 100% 4.050 2.835 N HAGH n/a
8 TRCN0000050836 GTACACCATCAACAACCTCAA pLKO.1 1073 CDS 100% 4.050 2.835 N HAGH n/a
9 TRCN0000234894 CCCTGCACCTTCAGCGGATTT pLKO_005 1404 3UTR 100% 3.600 2.520 N HAGH n/a
10 TRCN0000050835 CATTTGTTACTTCGTGAGCAA pLKO.1 893 CDS 100% 2.640 1.848 N HAGH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363912.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00724 pDONR223 100% 77.1% 73.4% None (many diffs) n/a
2 TRCN0000479250 GGTTCCCATTCTACTTTAGTTATT pLX_317 45.7% 77.1% 73.4% V5 (many diffs) n/a
3 ccsbBroadEn_06349 pDONR223 100% 76.9% 73.4% None (many diffs) n/a
4 ccsbBroad304_06349 pLX_304 0% 76.9% 73.4% V5 (many diffs) n/a
5 TRCN0000473043 CGGACTTTACTCCAGCCACCACTG pLX_317 67.1% 76.9% 73.4% V5 (many diffs) n/a
Download CSV