Transcript: Human NM_001364113.1

Homo sapiens chromodomain helicase DNA binding protein 1 (CHD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
CHD1 (1105)
Length:
7895
CDS:
1325..6721

Additional Resources:

NCBI RefSeq record:
NM_001364113.1
NBCI Gene record:
CHD1 (1105)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359226 CAAATAGTGGAACGTATAATT pLKO_005 2489 CDS 100% 15.000 21.000 N CHD1 n/a
2 TRCN0000234342 TGATGAAGCACACCGATTAAA pLKO_005 3163 CDS 100% 15.000 21.000 N CHD1 n/a
3 TRCN0000359159 AGGGTCCAACATTCCGAATAT pLKO_005 4917 CDS 100% 13.200 18.480 N CHD1 n/a
4 TRCN0000021309 GCGGTTTATCAAGAGCTATAA pLKO.1 4720 CDS 100% 13.200 18.480 N CHD1 n/a
5 TRCN0000096528 CGTGCAGACTACCTCATCAAA pLKO.1 5237 CDS 100% 5.625 7.875 N Chd1 n/a
6 TRCN0000021311 GCGCAGTAGAAGTAGGAGATA pLKO.1 4588 CDS 100% 4.950 6.930 N CHD1 n/a
7 TRCN0000096527 CCATCCTATATTGGAGGACAT pLKO.1 2732 CDS 100% 4.050 5.670 N Chd1 n/a
8 TRCN0000021313 CCATCGTGATTGGGATCACTA pLKO.1 6340 CDS 100% 0.495 0.693 N CHD1 n/a
9 TRCN0000234343 CAAGCAAGACAGCAGATATTA pLKO_005 6361 CDS 100% 15.000 10.500 N CHD1 n/a
10 TRCN0000234345 CCAGGATGCAAGGTCTATTAT pLKO_005 6851 3UTR 100% 15.000 10.500 N CHD1 n/a
11 TRCN0000234344 CTGAATATACGCACCATAAAT pLKO_005 6528 CDS 100% 15.000 10.500 N CHD1 n/a
12 TRCN0000359156 TTTAGACTGACCTCCATTTAA pLKO_005 7045 3UTR 100% 15.000 10.500 N CHD1 n/a
13 TRCN0000218236 AGCATGCATTGATGAGTATTT pLKO_005 2626 CDS 100% 13.200 9.240 N CHD1 n/a
14 TRCN0000359227 CAGTACCATGATCATCATAAA pLKO_005 6242 CDS 100% 13.200 9.240 N CHD1 n/a
15 TRCN0000359158 CATAAACCAACACAGTAATTG pLKO_005 6769 3UTR 100% 13.200 9.240 N CHD1 n/a
16 TRCN0000021312 GCAGTTGTGATGAAACAGAAT pLKO.1 1842 CDS 100% 4.950 3.465 N CHD1 n/a
17 TRCN0000021310 CCACTCTTACTTCCTGGCAAA pLKO.1 2943 CDS 100% 4.050 2.835 N CHD1 n/a
18 TRCN0000159276 GAAGAAGAAGAAAGACAAAGA pLKO.1 4490 CDS 100% 4.950 2.475 Y C1orf35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10732 pDONR223 100% 95% 95% None 4108_4371del;4599G>A;5312_5314delCTC n/a
2 ccsbBroad304_10732 pLX_304 0% 95% 95% V5 4108_4371del;4599G>A;5312_5314delCTC n/a
3 TRCN0000478855 TATACTCCTCCAAGGTGGACAACT pLX_317 7.3% 95% 95% V5 4108_4371del;4599G>A;5312_5314delCTC n/a
Download CSV