Transcript: Human NM_001364120.1

Homo sapiens adaptor related protein complex 3 subunit sigma 1 (AP3S1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
AP3S1 (1176)
Length:
1233
CDS:
93..509

Additional Resources:

NCBI RefSeq record:
NM_001364120.1
NBCI Gene record:
AP3S1 (1176)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379473 CATTGGTGACATCAGTATAAA pLKO_005 595 3UTR 100% 15.000 10.500 N AP3S1 n/a
2 TRCN0000113166 CCGTGCTGTATCAGCTGTAAA pLKO.1 538 3UTR 100% 13.200 9.240 N Ap3s1 n/a
3 TRCN0000060316 CTTCCTGAGATCCCAAGAAAT pLKO.1 569 3UTR 100% 13.200 9.240 N AP3S1 n/a
4 TRCN0000290032 CTTCCTGAGATCCCAAGAAAT pLKO_005 569 3UTR 100% 13.200 9.240 N AP3S1 n/a
5 TRCN0000380624 ACTTTCCATTTGGTATCTAAG pLKO_005 195 CDS 100% 10.800 7.560 N AP3S1 n/a
6 TRCN0000381405 CACAAGTGCAGCATTCCTTAA pLKO_005 1000 3UTR 100% 10.800 7.560 N AP3S1 n/a
7 TRCN0000113165 CCAAGTATGTATTGCATGAAA pLKO.1 1060 3UTR 100% 5.625 3.938 N Ap3s1 n/a
8 TRCN0000309509 CCAAGTATGTATTGCATGAAA pLKO_005 1060 3UTR 100% 5.625 3.938 N Ap3s1 n/a
9 TRCN0000296529 ACTGATTTATAGACATTATGC pLKO_005 278 CDS 100% 4.950 3.465 N AP3S1 n/a
10 TRCN0000060313 CCCTACAGTGAAGATACACAA pLKO.1 156 CDS 100% 4.950 3.465 N AP3S1 n/a
11 TRCN0000060314 GCAAATCATCAGGGAGACTTT pLKO.1 179 CDS 100% 4.950 3.465 N AP3S1 n/a
12 TRCN0000060317 GTAATTTCCTAGAAGGAGGAT pLKO.1 232 CDS 100% 2.640 1.848 N AP3S1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00320 pDONR223 100% 69.9% 66.3% None (many diffs) n/a
2 ccsbBroad304_00320 pLX_304 0% 69.9% 66.3% V5 (many diffs) n/a
3 TRCN0000474919 TGCGCCCAAACAGCAAGTCATGCG pLX_317 69.4% 69.9% 66.3% V5 (many diffs) n/a
Download CSV