Transcript: Human NM_001364502.2

Homo sapiens dipeptidyl peptidase like 6 (DPP6), transcript variant 11, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DPP6 (1804)
Length:
2243
CDS:
337..786

Additional Resources:

NCBI RefSeq record:
NM_001364502.2
NBCI Gene record:
DPP6 (1804)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364502.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364502.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14618 pDONR223 50.6% 17.2% 16.3% None (many diffs) n/a
2 ccsbBroadEn_06117 pDONR223 100% 17.1% 16.3% None (many diffs) n/a
3 TRCN0000475895 TGACCAGGCTTGGCCAATGACTTC pLX_317 14.3% 17.1% 16.3% V5 (many diffs) n/a
Download CSV