Transcript: Human NM_001364601.1

Homo sapiens phosphodiesterase 4D (PDE4D), transcript variant 15, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
PDE4D (5144)
Length:
3388
CDS:
340..798

Additional Resources:

NCBI RefSeq record:
NM_001364601.1
NBCI Gene record:
PDE4D (5144)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236069 TATCGATCCGACAGCGATTAT pLKO_005 724 CDS 100% 13.200 18.480 N PDE4D n/a
2 TRCN0000048833 CGGGCTAATTCTCCAAGCAAA pLKO.1 669 CDS 100% 4.950 6.930 N PDE4D n/a
3 TRCN0000166364 CACACACACACACACACACAA pLKO.1 984 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11023 pDONR223 100% 69.2% 68.9% None 456_456delGins202 n/a
2 ccsbBroad304_11023 pLX_304 0% 69.2% 68.9% V5 456_456delGins202 n/a
3 TRCN0000471607 GTCAGCGCGAATCGTGATTTCGTT pLX_317 79.6% 69.2% 68.9% V5 456_456delGins202 n/a
Download CSV