Transcript: Human NM_001365023.1

Homo sapiens RAR related orphan receptor B (RORB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
RORB (6096)
Length:
9038
CDS:
67..1479

Additional Resources:

NCBI RefSeq record:
NM_001365023.1
NBCI Gene record:
RORB (6096)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365023.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421952 GCCCAAGTCTGAGGGTTATTA pLKO_005 546 CDS 100% 15.000 21.000 N RORB n/a
2 TRCN0000414887 GGAGTTTGCAAAGCGGATAAC pLKO_005 921 CDS 100% 10.800 15.120 N RORB n/a
3 TRCN0000022171 CCGTTATACAAGGAGCTCTTT pLKO.1 1429 CDS 100% 4.950 6.930 N RORB n/a
4 TRCN0000022170 CCGTGCCTTCAACCCATTAAA pLKO.1 1023 CDS 100% 15.000 10.500 N RORB n/a
5 TRCN0000426331 CATGGAATGCATCACCATTAA pLKO_005 1506 3UTR 100% 13.200 9.240 N RORB n/a
6 TRCN0000422403 GAGCGGTACTTTACATGATTA pLKO_005 1800 3UTR 100% 13.200 9.240 N RORB n/a
7 TRCN0000022173 GCAAAGTTAATAGCCAAGATA pLKO.1 1318 CDS 100% 5.625 3.938 N RORB n/a
8 TRCN0000022172 CCCAAGGCAGAGAAACTGTTT pLKO.1 237 CDS 100% 4.950 3.465 N RORB n/a
9 TRCN0000022169 CCCACACCTATGAAGAAATTA pLKO.1 821 CDS 100% 15.000 9.000 N RORB n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5185 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365023.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491512 CGTTTACCCCCCGCCGCCCACGTC pLX_317 20.7% 97.5% 97.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488384 TATAAGGCACCCAATAACCGAGAT pLX_317 13.6% 97.4% 97% V5 (many diffs) n/a
Download CSV