Transcript: Human NM_001365079.1

Homo sapiens SH3 and PX domains 2A (SH3PXD2A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
SH3PXD2A (9644)
Length:
10854
CDS:
21..3065

Additional Resources:

NCBI RefSeq record:
NM_001365079.1
NBCI Gene record:
SH3PXD2A (9644)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136014 GCCTTTGGTTTGCGTCTTATT pLKO.1 3921 3UTR 100% 13.200 18.480 N SH3PXD2A n/a
2 TRCN0000434249 GGTATTGTCCTAAGCTGTATT pLKO_005 3516 3UTR 100% 13.200 18.480 N SH3PXD2A n/a
3 TRCN0000425725 GCCAAAGCAAGGACGAGATTG pLKO_005 499 CDS 100% 10.800 15.120 N SH3PXD2A n/a
4 TRCN0000136512 CATCGAGAAGTCTCAGTTCAT pLKO.1 2849 CDS 100% 4.950 6.930 N SH3PXD2A n/a
5 TRCN0000136337 GTATATCAGATACCTGGGCAA pLKO.1 575 CDS 100% 2.160 1.728 N SH3PXD2A n/a
6 TRCN0000105733 CGTGGTGGTGTCCAACTATAA pLKO.1 176 CDS 100% 13.200 9.240 N Sh3pxd2a n/a
7 TRCN0000135838 CGGTAGAGAAAGCAACAGAAT pLKO.1 7865 3UTR 100% 4.950 3.465 N SH3PXD2A n/a
8 TRCN0000136336 GCCTTTGATTTCGGACAGATT pLKO.1 4698 3UTR 100% 4.950 3.465 N SH3PXD2A n/a
9 TRCN0000135150 CATCTATGAGAATGAGGGCTT pLKO.1 1517 CDS 100% 2.160 1.512 N SH3PXD2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.