Transcript: Human NM_001365213.2

Homo sapiens aspartyl-tRNA synthetase 2, mitochondrial (DARS2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
DARS2 (55157)
Length:
2084
CDS:
558..2006

Additional Resources:

NCBI RefSeq record:
NM_001365213.2
NBCI Gene record:
DARS2 (55157)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365213.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153353 GCGTAGTTTCCAAATGCAGTA pLKO.1 1091 CDS 100% 4.050 5.670 N DARS2 n/a
2 TRCN0000281286 GCGTAGTTTCCAAATGCAGTA pLKO_005 1091 CDS 100% 4.050 5.670 N DARS2 n/a
3 TRCN0000153000 GCCACCTATGGAACTGATAAA pLKO.1 1533 CDS 100% 13.200 10.560 N DARS2 n/a
4 TRCN0000281285 GCCACCTATGGAACTGATAAA pLKO_005 1533 CDS 100% 13.200 10.560 N DARS2 n/a
5 TRCN0000154132 CATGGAACTGTGAAAGCCATA pLKO.1 1647 CDS 100% 4.050 2.835 N DARS2 n/a
6 TRCN0000154133 CCTGTATTCCTTAACGCCAAT pLKO.1 1758 CDS 100% 4.050 2.835 N DARS2 n/a
7 TRCN0000281284 CCTGTATTCCTTAACGCCAAT pLKO_005 1758 CDS 100% 4.050 2.835 N DARS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365213.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03538 pDONR223 100% 72.9% 70.3% None (many diffs) n/a
2 ccsbBroad304_03538 pLX_304 0% 72.9% 70.3% V5 (many diffs) n/a
3 TRCN0000492112 ATGATTATGACTAATTATTGATTT pLX_317 23.3% 72.9% 70.3% V5 (many diffs) n/a
Download CSV