Transcript: Human NM_001365276.2

Homo sapiens tenascin XB (TNXB), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
TNXB (7148)
Length:
13097
CDS:
167..12901

Additional Resources:

NCBI RefSeq record:
NM_001365276.2
NBCI Gene record:
TNXB (7148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365276.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062163 CGACCGGAAGTATAAGATGAA pLKO.1 4129 CDS 100% 4.950 6.930 N TNXB n/a
2 TRCN0000062164 GCCCAGTAGGAAATACAGGTT pLKO.1 10408 CDS 100% 2.640 3.696 N TNXB n/a
3 TRCN0000373719 AGCTGACAGTGACGGATATAA pLKO_005 4911 CDS 100% 15.000 10.500 N TNXB n/a
4 TRCN0000373718 GCCTGGAGCCAGACCATAAAT pLKO_005 6297 CDS 100% 15.000 10.500 N TNXB n/a
5 TRCN0000373799 CCTGATGCCAGGCGTAGAATA pLKO_005 2857 CDS 100% 13.200 9.240 N TNXB n/a
6 TRCN0000062166 GCCAGACCACAAGTACAAGAT pLKO.1 6925 CDS 100% 4.950 3.465 N TNXB n/a
7 TRCN0000062165 CCCATCATCTACCAAGGCATT pLKO.1 3290 CDS 100% 4.050 2.835 N TNXB n/a
8 TRCN0000062167 CGTGACCTCCAATTCAGTGAA pLKO.1 11444 CDS 100% 4.950 2.475 Y TNXB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365276.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07087 pDONR223 100% 15.8% 15.8% None 1_10713del;11372A>T n/a
2 ccsbBroad304_07087 pLX_304 0% 15.8% 15.8% V5 1_10713del;11372A>T n/a
3 TRCN0000477336 TATCAGTAACCATCCTCGAAAGTT pLX_317 18.5% 15.8% 15.8% V5 1_10713del;11372A>T n/a
Download CSV