Transcript: Human NM_001365308.1

Homo sapiens BMP binding endothelial regulator (BMPER), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
BMPER (168667)
Length:
5287
CDS:
76..2133

Additional Resources:

NCBI RefSeq record:
NM_001365308.1
NBCI Gene record:
BMPER (168667)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365308.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377668 CAGGACGGAGTGTCGCAATAA pLKO_005 1056 CDS 100% 13.200 18.480 N BMPER n/a
2 TRCN0000073560 GCGCTGTGTTGTTCATTGTAA pLKO.1 504 CDS 100% 5.625 4.500 N BMPER n/a
3 TRCN0000073558 GCAGTATTTGTGTGCCCGATT pLKO.1 2206 3UTR 100% 4.050 3.240 N BMPER n/a
4 TRCN0000371432 AGATGTGGTCCTCTATCAATT pLKO_005 1010 CDS 100% 13.200 9.240 N BMPER n/a
5 TRCN0000073561 CCTCTTTCGAAGTGATGTTTA pLKO.1 789 CDS 100% 13.200 9.240 N BMPER n/a
6 TRCN0000073559 CGAAGTGATGTTTATGACAAT pLKO.1 796 CDS 100% 4.950 3.465 N BMPER n/a
7 TRCN0000073562 GATGACTTAATTGGTGGAGAT pLKO.1 1591 CDS 100% 4.050 2.835 N BMPER n/a
8 TRCN0000371433 GCGTCTTGCTGCTACTCAATT pLKO_005 146 CDS 100% 13.200 7.920 N BMPER n/a
9 TRCN0000200348 GTCCAGGCTGTGTGTTTGATT pLKO.1 563 CDS 100% 5.625 3.375 N Fam170a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365308.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.