Transcript: Human NM_001365416.1

Homo sapiens myocardin related transcription factor B (MRTFB), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
MRTFB (57496)
Length:
1970
CDS:
121..1050

Additional Resources:

NCBI RefSeq record:
NM_001365416.1
NBCI Gene record:
MRTFB (57496)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015393 CCAGTGTTAAAGAAGCAATTA pLKO.1 398 CDS 100% 13.200 9.240 N MRTFB n/a
2 TRCN0000232299 GTGTTAAAGAAGCAATTATAG pLKO_005 401 CDS 100% 13.200 9.240 N MRTFB n/a
3 TRCN0000232300 GATCCCAAACCACGGGTAAAG pLKO_005 790 CDS 100% 10.800 7.560 N MRTFB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12353 pDONR223 100% 79.2% 76.9% None (many diffs) n/a
2 ccsbBroad304_12353 pLX_304 0% 79.2% 76.9% V5 (many diffs) n/a
3 TRCN0000467244 CGATCCCTGGTATGATTTCTCTGG pLX_317 31.4% 79.2% 76.9% V5 (many diffs) n/a
Download CSV