Transcript: Human NM_001365692.1

Homo sapiens CCM2 like scaffold protein (CCM2L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
CCM2L (140706)
Length:
2599
CDS:
18..1733

Additional Resources:

NCBI RefSeq record:
NM_001365692.1
NBCI Gene record:
CCM2L (140706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365692.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166548 CGCGACAATGAAGAGCTCATT pLKO.1 384 CDS 100% 0.495 0.396 N CCM2L n/a
2 TRCN0000163004 GACCTCAAACTGACCATACTA pLKO.1 2219 3UTR 100% 5.625 3.938 N CCM2L n/a
3 TRCN0000164850 CCAGATTCTGCTGTGTGACTA pLKO.1 176 CDS 100% 4.950 3.465 N CCM2L n/a
4 TRCN0000166505 CCTGGAGAAAGAGGTCAAGTT pLKO.1 197 CDS 100% 4.950 3.465 N CCM2L n/a
5 TRCN0000417260 CTGTCAGGTCTTCCAGATCAT pLKO_005 980 CDS 100% 4.950 3.465 N CCM2L n/a
6 TRCN0000166099 GCTTGGAGCAGTTACAGGATT pLKO.1 1249 CDS 100% 4.950 3.465 N CCM2L n/a
7 TRCN0000166504 CACTACACATCCACACCTGAA pLKO.1 1044 CDS 100% 4.050 2.835 N CCM2L n/a
8 TRCN0000165399 CGCAGAAGACAACTACCTGTA pLKO.1 1712 CDS 100% 4.050 2.835 N CCM2L n/a
9 TRCN0000166703 CCAGAGTATTGAGTGTGTGGA pLKO.1 1010 CDS 100% 2.640 1.848 N CCM2L n/a
10 TRCN0000436024 CCTACTGCAACCTGGTCATTC pLKO_005 913 CDS 100% 10.800 7.560 N Ccm2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365692.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14387 pDONR223 100% 26.7% 26.6% None 1_1254del;1475A>G n/a
2 ccsbBroad304_14387 pLX_304 0% 26.7% 26.6% V5 1_1254del;1475A>G n/a
3 TRCN0000473762 CCATGGTATTATAGACGTCGGTCT pLX_317 100% 26.7% 26.6% V5 1_1254del;1475A>G n/a
Download CSV