Transcript: Human NM_001366011.1

Homo sapiens CDC42 binding protein kinase alpha (CDC42BPA), transcript variant E, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
CDC42BPA (8476)
Length:
10820
CDS:
1311..6410

Additional Resources:

NCBI RefSeq record:
NM_001366011.1
NBCI Gene record:
CDC42BPA (8476)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195596 CCAGGCTAGTGAGCGATTAAA pLKO.1 2966 CDS 100% 15.000 21.000 N CDC42BPA n/a
2 TRCN0000194939 CAGAATCATTTCACCAGTTAA pLKO.1 7888 3UTR 100% 13.200 18.480 N CDC42BPA n/a
3 TRCN0000194832 CGGAAAGATATACCCTGTATA pLKO.1 4677 CDS 100% 13.200 18.480 N CDC42BPA n/a
4 TRCN0000000662 GCAAGAGATAACCAAACTAAA pLKO.1 3359 CDS 100% 13.200 18.480 N CDC42BPA n/a
5 TRCN0000001333 GCAAGAGATAACCAAACTAAA pLKO.1 3359 CDS 100% 13.200 18.480 N CDC42BPA n/a
6 TRCN0000022979 CCAGGATGACAATAACTTATA pLKO.1 1742 CDS 100% 13.200 10.560 N LOC381309 n/a
7 TRCN0000196514 GTGGAATTGATTGGGATAATA pLKO.1 2341 CDS 100% 15.000 10.500 N CDC42BPA n/a
8 TRCN0000194982 CAGTTAGAAGAAGAGGTTAAA pLKO.1 3705 CDS 100% 13.200 9.240 N CDC42BPA n/a
9 TRCN0000000659 CCGCAGATAAATGTAGAAATA pLKO.1 7373 3UTR 100% 13.200 9.240 N CDC42BPA n/a
10 TRCN0000001330 CCGCAGATAAATGTAGAAATA pLKO.1 7373 3UTR 100% 13.200 9.240 N CDC42BPA n/a
11 TRCN0000196639 GCAGAATCAGAAGGATCTATT pLKO.1 7863 3UTR 100% 13.200 9.240 N CDC42BPA n/a
12 TRCN0000196893 GTTGTTACAATGCACCATATC pLKO.1 5575 CDS 100% 10.800 7.560 N CDC42BPA n/a
13 TRCN0000000660 GCGATTACATAGAGAAGACTT pLKO.1 1520 CDS 100% 4.950 3.465 N CDC42BPA n/a
14 TRCN0000001331 GCGATTACATAGAGAAGACTT pLKO.1 1520 CDS 100% 4.950 3.465 N CDC42BPA n/a
15 TRCN0000000663 GCTCAGTCAGTATTCCATCTA pLKO.1 6040 CDS 100% 4.950 3.465 N CDC42BPA n/a
16 TRCN0000001334 GCTCAGTCAGTATTCCATCTA pLKO.1 6040 CDS 100% 4.950 3.465 N CDC42BPA n/a
17 TRCN0000000661 CGCTCAGTCTATGTTCCCAAA pLKO.1 4842 CDS 100% 4.050 2.835 N CDC42BPA n/a
18 TRCN0000001332 CGCTCAGTCTATGTTCCCAAA pLKO.1 4842 CDS 100% 4.050 2.835 N CDC42BPA n/a
19 TRCN0000199935 GCTCGCCATGTCCGAGATAAG pLKO.1 3099 CDS 100% 3.600 2.520 N CDC42BPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.