Transcript: Human NM_001366226.1

Homo sapiens synaptotagmin 6 (SYT6), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
SYT6 (148281)
Length:
4320
CDS:
270..1601

Additional Resources:

NCBI RefSeq record:
NM_001366226.1
NBCI Gene record:
SYT6 (148281)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379736 GGCTCACCCTCACAGTGATTA pLKO_005 1144 CDS 100% 13.200 18.480 N SYT6 n/a
2 TRCN0000236303 TAGTCTGGTAGTCCTACATTT pLKO_005 3332 3UTR 100% 13.200 18.480 N SYT6 n/a
3 TRCN0000236306 CACTCCTTGGTGGAGGTAAAG pLKO_005 1494 CDS 100% 10.800 15.120 N SYT6 n/a
4 TRCN0000155746 CGATGGACATCACAGGCTATT pLKO.1 1183 CDS 100% 10.800 15.120 N SYT6 n/a
5 TRCN0000236302 TTCAGCCTACGCTACGATTAC pLKO_005 717 CDS 100% 10.800 15.120 N SYT6 n/a
6 TRCN0000154956 GCATCTCAGTGTCTTCGACTT pLKO.1 950 CDS 100% 4.050 5.670 N SYT6 n/a
7 TRCN0000154675 GATCAACTTCAGCCTACGCTA pLKO.1 710 CDS 100% 2.640 3.696 N SYT6 n/a
8 TRCN0000236304 ATCTGGAAGGATATCCAATAT pLKO_005 1056 CDS 100% 13.200 10.560 N SYT6 n/a
9 TRCN0000380627 ATGAGATGTGCAGCCAAATAA pLKO_005 1598 CDS 100% 15.000 10.500 N SYT6 n/a
10 TRCN0000380878 GCACTTGTTCAACCGTCTAAA pLKO_005 1648 3UTR 100% 13.200 9.240 N SYT6 n/a
11 TRCN0000236305 ATCTCAGTGTCTTCGACTTTG pLKO_005 952 CDS 100% 10.800 7.560 N SYT6 n/a
12 TRCN0000380753 ATGTCTCCAGTGTAGACTATG pLKO_005 565 CDS 100% 10.800 7.560 N SYT6 n/a
13 TRCN0000381748 GATGGACATCACAGGCTATTC pLKO_005 1184 CDS 100% 10.800 7.560 N SYT6 n/a
14 TRCN0000175010 GAGGTAAAGAAATCCTTCAAA pLKO.1 1506 CDS 100% 5.625 3.938 N Syt6 n/a
15 TRCN0000154596 GCATGTCTCCAGTGTAGACTA pLKO.1 563 CDS 100% 4.950 3.465 N SYT6 n/a
16 TRCN0000156189 CACAAGTGAAAGCGTGGACTT pLKO.1 1079 CDS 100% 4.050 2.835 N SYT6 n/a
17 TRCN0000154940 GCTCATCTCAGTCATGGACTA pLKO.1 1352 CDS 100% 4.050 2.835 N SYT6 n/a
18 TRCN0000154644 CCGTCTAAACAGTGTTGTGCA pLKO.1 1660 3UTR 100% 2.640 1.848 N SYT6 n/a
19 TRCN0000380698 CTCTCAATCCTGTCTACAATG pLKO_005 1282 CDS 100% 10.800 6.480 N SYT6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05010 pDONR223 100% 95.4% 95% None (many diffs) n/a
2 ccsbBroad304_05010 pLX_304 0% 95.4% 95% V5 (many diffs) n/a
3 TRCN0000471407 GGGTGCAAATAAAATGAGCCCCAC pLX_317 29.2% 95.4% 95% V5 (many diffs) n/a
Download CSV