Transcript: Human NM_001366627.1

Homo sapiens transmembrane protein 196 (TMEM196), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
TMEM196 (256130)
Length:
3257
CDS:
109..444

Additional Resources:

NCBI RefSeq record:
NM_001366627.1
NBCI Gene record:
TMEM196 (256130)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341833 CCTGCATCACTCTCATGAAAT pLKO_005 333 CDS 100% 13.200 10.560 N Tmem196 n/a
2 TRCN0000141703 CCAGTTATGAACAGAGGAGGA pLKO.1 290 CDS 100% 2.160 1.728 N TMEM196 n/a
3 TRCN0000143993 CCCAATTCCTTTGGATAACTT pLKO.1 2337 3UTR 100% 5.625 3.938 N TMEM196 n/a
4 TRCN0000143917 CAGTTATGAACAGAGGAGGAT pLKO.1 291 CDS 100% 2.640 1.848 N TMEM196 n/a
5 TRCN0000142407 GAGGATGTTCTCAGAAAGGGA pLKO.1 306 CDS 100% 0.750 0.525 N TMEM196 n/a
6 TRCN0000122786 GCACTCTCTCTTCCTGGCTCA pLKO.1 257 CDS 100% 0.720 0.504 N TMEM196 n/a
7 TRCN0000122729 CTCTCATGAAATGGCTGAGAA pLKO.1 342 CDS 100% 0.495 0.347 N TMEM196 n/a
8 TRCN0000143729 GTTATGAACAGAGGAGGATGT pLKO.1 293 CDS 100% 4.050 2.430 N TMEM196 n/a
9 TRCN0000144530 CCACAGCTGATATTTAATGGA pLKO.1 468 3UTR 100% 3.000 1.800 N TMEM196 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13474 pDONR223 100% 80.1% 78.3% None 256_257delAG;270_333del n/a
2 ccsbBroad304_13474 pLX_304 0% 80.1% 78.3% V5 256_257delAG;270_333del n/a
3 TRCN0000467242 TGTCGCACCGGAAGCGTACAAGAA pLX_317 100% 80.1% 78.3% V5 256_257delAG;270_333del n/a
Download CSV