Transcript: Human NM_001366722.1

Homo sapiens glutamate receptor interacting protein 1 (GRIP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
GRIP1 (23426)
Length:
5147
CDS:
173..3559

Additional Resources:

NCBI RefSeq record:
NM_001366722.1
NBCI Gene record:
GRIP1 (23426)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366722.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257745 GAAAGTTCCGGAGCAATTATT pLKO_005 2165 CDS 100% 15.000 21.000 N GRIP1 n/a
2 TRCN0000245914 GATGAGAGTCCCTACACTAAA pLKO_005 227 CDS 100% 13.200 18.480 N GRIP1 n/a
3 TRCN0000245915 CATAGCAGAATCCGGGAATAA pLKO_005 3382 CDS 100% 13.200 10.560 N GRIP1 n/a
4 TRCN0000245916 AGAGCCGTTTGATCCTATAAT pLKO_005 2245 CDS 100% 15.000 10.500 N GRIP1 n/a
5 TRCN0000245913 GGCAAGCCAAGAGTATCTAAT pLKO_005 398 CDS 100% 13.200 9.240 N GRIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366722.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07882 pDONR223 100% 95.3% 95.2% None 1043_1198del;2461C>G n/a
2 ccsbBroad304_07882 pLX_304 0% 95.3% 95.2% V5 1043_1198del;2461C>G n/a
3 TRCN0000468758 TCCCCCAACCTGCTTCACAAAGAC pLX_317 13.6% 95.3% 95.2% V5 1043_1198del;2461C>G n/a
Download CSV