Transcript: Human NM_001367206.1

Homo sapiens chordin like 1 (CHRDL1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
CHRDL1 (91851)
Length:
3845
CDS:
109..1470

Additional Resources:

NCBI RefSeq record:
NM_001367206.1
NBCI Gene record:
CHRDL1 (91851)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371790 ACGCCATGCACAGCATAATTT pLKO_005 1593 3UTR 100% 15.000 21.000 N CHRDL1 n/a
2 TRCN0000148679 CATCAGGAACCATTGTGCAAA pLKO.1 833 CDS 100% 4.950 3.960 N CHRDL1 n/a
3 TRCN0000149739 GAGAACTGTCATGGGAACATT pLKO.1 656 CDS 100% 5.625 3.938 N CHRDL1 n/a
4 TRCN0000147556 GCTGTTTAAGTCACCAACAAT pLKO.1 2185 3UTR 100% 5.625 3.938 N CHRDL1 n/a
5 TRCN0000150226 GTCCAAATGTTCATTGCCTTT pLKO.1 347 CDS 100% 4.050 2.835 N CHRDL1 n/a
6 TRCN0000371791 ACTCAAATGCAGTCAATTATT pLKO_005 1571 3UTR 100% 15.000 9.000 N CHRDL1 n/a
7 TRCN0000147858 GCCTCATTCATTCACTTAGAA pLKO.1 2239 3UTR 100% 5.625 3.375 N CHRDL1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1992 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04563 pDONR223 100% 98.9% 98.6% None 300_302delAGA;973_974insGTAAAAAAGCAA n/a
2 ccsbBroad304_04563 pLX_304 0% 98.9% 98.6% V5 300_302delAGA;973_974insGTAAAAAAGCAA n/a
3 TRCN0000477772 TGTGGTCCGCAAAAGACCAATAAG pLX_317 20.2% 98.9% 98.6% V5 300_302delAGA;973_974insGTAAAAAAGCAA n/a
Download CSV