Transcript: Human NM_001367290.1

Homo sapiens innate immunity activator (INAVA), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
INAVA (55765)
Length:
4130
CDS:
818..2017

Additional Resources:

NCBI RefSeq record:
NM_001367290.1
NBCI Gene record:
INAVA (55765)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000441809 AGCTCCAGGCTACCTACACAA pLKO_005 196 5UTR 100% 4.950 6.930 N INAVA n/a
2 TRCN0000437102 AGGATCGGAGCGGCTTACAAA pLKO_005 532 5UTR 100% 5.625 3.938 N INAVA n/a
3 TRCN0000140233 GCTATGCTTCTGCTCTGAGAA pLKO.1 3261 3UTR 100% 4.950 3.465 N INAVA n/a
4 TRCN0000438593 CAGTTTGTGTGCTGCGGAGAT pLKO_005 1932 CDS 100% 4.050 2.835 N INAVA n/a
5 TRCN0000139149 CCTGTGCAAGTCTTTGTACCT pLKO.1 1967 CDS 100% 2.640 1.584 N INAVA n/a
6 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3059 3UTR 100% 4.950 2.475 Y LOC387873 n/a
7 TRCN0000140759 GCCTTTCAAAGTGCTGGGATT pLKO.1 3092 3UTR 100% 4.050 2.025 Y INAVA n/a
8 TRCN0000155070 GCCTTTCAAAGTGCTGGGATT pLKO.1 3092 3UTR 100% 4.050 2.025 Y ASB6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08584 pDONR223 100% 60% 58.3% None (many diffs) n/a
2 TRCN0000470845 CTACACCCTTAAGGCGGGTTAGCA pLX_317 17% 60% 58.3% V5 (many diffs) n/a
Download CSV