Transcript: Human NM_001367783.1

Homo sapiens zinc finger protein 704 (ZNF704), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ZNF704 (619279)
Length:
15100
CDS:
425..2185

Additional Resources:

NCBI RefSeq record:
NM_001367783.1
NBCI Gene record:
ZNF704 (619279)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367783.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163387 GACTAAGTTGATGACGCCGTT pLKO.1 1798 CDS 100% 2.160 3.024 N ZNF704 n/a
2 TRCN0000161380 GCACAGGTATAAGCAGAACTA pLKO.1 4609 3UTR 100% 4.950 3.960 N ZNF704 n/a
3 TRCN0000159103 GCTTTCTGAATTATGCCATTT pLKO.1 2543 3UTR 100% 10.800 7.560 N ZNF704 n/a
4 TRCN0000162878 GCCATGGAGGAAGATGTGAAA pLKO.1 1025 CDS 100% 4.950 3.465 N ZNF704 n/a
5 TRCN0000443140 AGCCGAACAGAAACTCCTTGT pLKO_005 1766 CDS 100% 4.050 2.835 N Zfp704 n/a
6 TRCN0000162553 CAATGGTACTAACCAGCTTGT pLKO.1 1209 CDS 100% 4.050 2.835 N ZNF704 n/a
7 TRCN0000162877 GCTTCAGCATTTCCTGGCAAT pLKO.1 1929 CDS 100% 4.050 2.835 N ZNF704 n/a
8 TRCN0000164035 CAGCAGGTATCCAGAAACACA pLKO.1 1566 CDS 100% 3.000 2.100 N ZNF704 n/a
9 TRCN0000160806 CGGAGCTATTTGTTACTGCTT pLKO.1 3071 3UTR 100% 2.640 1.848 N ZNF704 n/a
10 TRCN0000163139 GAACAGAAACTCCTTGTGCCA pLKO.1 1770 CDS 100% 0.660 0.462 N ZNF704 n/a
11 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 11080 3UTR 100% 4.950 2.475 Y NPHS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367783.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05707 pDONR223 100% 70.3% 70.3% None 1_522del n/a
2 ccsbBroad304_05707 pLX_304 0% 70.3% 70.3% V5 1_522del n/a
Download CSV