Transcript: Human NM_001367996.1

Homo sapiens ninjurin 2 (NINJ2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
NINJ2 (4815)
Length:
1057
CDS:
333..653

Additional Resources:

NCBI RefSeq record:
NM_001367996.1
NBCI Gene record:
NINJ2 (4815)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367996.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063776 CCTGTTCATGTCCAACGCCAT pLKO.1 347 CDS 100% 2.160 3.024 N NINJ2 n/a
2 TRCN0000063773 CGTGGTCATTGCACGGCTGAA pLKO.1 476 CDS 100% 1.350 1.080 N NINJ2 n/a
3 TRCN0000063775 CTGAACCTGAATGAGGTAGAA pLKO.1 492 CDS 100% 4.950 3.465 N NINJ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367996.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10998 pDONR223 100% 74.4% 74.6% None 0_1ins108;297C>A n/a
2 ccsbBroad304_10998 pLX_304 0% 74.4% 74.6% V5 0_1ins108;297C>A n/a
3 TRCN0000475170 AGCCCAACGAGTGCGATAGTGCGA pLX_317 82.2% 74.4% 74.6% V5 0_1ins108;297C>A n/a
Download CSV