Transcript: Human NM_001368307.2

Homo sapiens CD8b2 molecule (CD8B2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CD8B2 (927)
Length:
989
CDS:
64..729

Additional Resources:

NCBI RefSeq record:
NM_001368307.2
NBCI Gene record:
CD8B2 (927)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001368307.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371762 TCAGCTGAGTGTGGTTGATTT pLKO_005 453 CDS 100% 13.200 6.600 Y CD8B n/a
2 TRCN0000057512 GCAAGCCGGTTCATTCTCAAT pLKO.1 349 CDS 100% 4.950 2.475 Y CD8B n/a
3 TRCN0000057509 CCTGCATACATAAAGGTGCAA pLKO.1 139 CDS 100% 2.640 1.320 Y CD8B n/a
4 TRCN0000057510 GCTTCGTTTCATGAAACAATT pLKO.1 666 CDS 100% 13.200 6.600 Y CD8B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001368307.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05956 pDONR223 100% 85.3% 84.3% None (many diffs) n/a
2 ccsbBroad304_05956 pLX_304 0% 85.3% 84.3% V5 (many diffs) n/a
3 TRCN0000466988 TTTGATACTTCGTTTTAAGAATTT pLX_317 48.5% 85.3% 84.3% V5 (many diffs) n/a
Download CSV