Transcript: Human NM_001368907.1

Homo sapiens paired box 6 (PAX6), transcript variant 28, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PAX6 (5080)
Length:
7240
CDS:
1238..2098

Additional Resources:

NCBI RefSeq record:
NM_001368907.1
NBCI Gene record:
PAX6 (5080)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001368907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246166 AGGGCAATCGGTGGTAGTAAA pLKO_005 1034 5UTR 100% 13.200 18.480 N PAX6 n/a
2 TRCN0000016126 GCAGACGGCATGTATGATAAA pLKO.1 1244 CDS 100% 13.200 18.480 N PAX6 n/a
3 TRCN0000075375 GACGGCATGTATGATAAACTA pLKO.1 1247 CDS 100% 5.625 7.875 N Pax6 n/a
4 TRCN0000016123 GCAAGAATACAGGTATGGTTT pLKO.1 1583 CDS 100% 4.950 6.930 N PAX6 n/a
5 TRCN0000246164 AGTTTGAGAGAACCCATTATC pLKO_005 1512 CDS 100% 13.200 10.560 N PAX6 n/a
6 TRCN0000246163 TCGGTGAATGGGCGGAGTTAT pLKO_005 1916 CDS 100% 13.200 10.560 N PAX6 n/a
7 TRCN0000016125 CGTCCATCTTTGCTTGGGAAA pLKO.1 1113 5UTR 100% 4.050 3.240 N PAX6 n/a
8 TRCN0000246165 AGCAACACACCTAGTCATATT pLKO_005 1664 CDS 100% 13.200 9.240 N PAX6 n/a
9 TRCN0000246162 ATACGCACTGTTGGTACAATT pLKO_005 4411 3UTR 100% 13.200 9.240 N PAX6 n/a
10 TRCN0000075374 CCACTTCAACAGGACTCATTT pLKO.1 2001 CDS 100% 13.200 9.240 N Pax6 n/a
11 TRCN0000075373 CCAAGTTTGTATCATTCCTTT pLKO.1 2558 3UTR 100% 4.950 3.465 N Pax6 n/a
12 TRCN0000016127 CATGGCAAATAACCTGCCTAT pLKO.1 1837 CDS 100% 4.050 2.835 N PAX6 n/a
13 TRCN0000075377 CCTGAAGCAAGAATACAGGTA pLKO.1 1577 CDS 100% 2.640 1.848 N Pax6 n/a
14 TRCN0000016124 CGGCAGAAGATTGTAGAGCTA pLKO.1 905 5UTR 100% 2.640 1.848 N PAX6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001368907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.