Transcript: Human NM_001368994.1

Homo sapiens adaptor related protein complex 1 subunit sigma 2 (AP1S2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
AP1S2 (8905)
Length:
2062
CDS:
127..588

Additional Resources:

NCBI RefSeq record:
NM_001368994.1
NBCI Gene record:
AP1S2 (8905)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001368994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059456 CCCACTATCAGACAAAGAGAA pLKO.1 186 CDS 100% 4.950 2.970 N AP1S2 n/a
2 TRCN0000333442 CCCACTATCAGACAAAGAGAA pLKO_005 186 CDS 100% 4.950 2.970 N AP1S2 n/a
3 TRCN0000059457 GCGAGATCTGAAGATTGTTTA pLKO.1 279 CDS 100% 13.200 6.600 Y AP1S2 n/a
4 TRCN0000333505 GCGAGATCTGAAGATTGTTTA pLKO_005 279 CDS 100% 13.200 6.600 Y AP1S2 n/a
5 TRCN0000313402 CTATTGAGGATCAGGACAATG pLKO_005 332 CDS 100% 10.800 5.400 Y Ap1s2 n/a
6 TRCN0000059455 GCAGTGTCTGTGAACTAGATA pLKO.1 410 CDS 100% 5.625 2.813 Y AP1S2 n/a
7 TRCN0000333506 GCAGTGTCTGTGAACTAGATA pLKO_005 410 CDS 100% 5.625 2.813 Y AP1S2 n/a
8 TRCN0000059453 CCTGGAAATAATTCATCGTTA pLKO.1 363 CDS 100% 4.950 2.475 Y AP1S2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001368994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02047 pDONR223 100% 92.3% 91.7% None (many diffs) n/a
2 ccsbBroad304_02047 pLX_304 0% 92.3% 91.7% V5 (many diffs) n/a
3 TRCN0000473696 CCATGTTTTGTACAACTTATCTTT pLX_317 86.3% 92.3% 91.7% V5 (many diffs) n/a
Download CSV